| Variant ID: vg0603303699 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 3303699 |
| Reference Allele: C | Alternative Allele: T,A,CA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTATTTTCCGCGTACATATTTTTCAAACTATTAAACGGTATGTTTTTTTAAAAAAAATCTATATGAAAACGGCTTAAAAAATCATATTAATACATTTAT[C/T,A,CA]
AAAAAAAATAGCTAATATTTAATTAATCACACACTAATTGATTATTTTGTCCTCCGTGCACACTGTTCCGGGGAACATCCACATATCCTATCCTTCAGAG
CTCTGAAGGATAGGATATGTGGATGTTCCCCGGAACAGTGTGCACGGAGGACAAAATAATCAATTAGTGTGTGATTAATTAAATATTAGCTATTTTTTTT[G/A,T,TG]
ATAAATGTATTAATATGATTTTTTAAGCCGTTTTCATATAGATTTTTTTTAAAAAAACATACCGTTTAATAGTTTGAAAAATATGTACGCGGAAAATAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 39.00% | 0.66% | 7.98% | A: 12.25%; CA: 1.14% |
| All Indica | 2759 | 33.40% | 41.30% | 0.58% | 9.03% | A: 13.77%; CA: 1.96% |
| All Japonica | 1512 | 47.60% | 43.30% | 0.79% | 8.00% | A: 0.33% |
| Aus | 269 | 31.20% | 0.40% | 0.00% | 0.00% | A: 68.40% |
| Indica I | 595 | 18.30% | 52.60% | 0.34% | 3.36% | A: 25.38% |
| Indica II | 465 | 54.00% | 22.80% | 0.65% | 19.14% | A: 3.44% |
| Indica III | 913 | 33.50% | 52.10% | 0.88% | 6.46% | CA: 5.81%; A: 1.20% |
| Indica Intermediate | 786 | 32.40% | 31.00% | 0.38% | 10.31% | A: 25.70%; CA: 0.13% |
| Temperate Japonica | 767 | 73.00% | 21.10% | 0.52% | 5.35% | NA |
| Tropical Japonica | 504 | 12.50% | 79.80% | 0.99% | 6.35% | A: 0.40% |
| Japonica Intermediate | 241 | 40.20% | 37.30% | 1.24% | 19.92% | A: 1.24% |
| VI/Aromatic | 96 | 88.50% | 7.30% | 0.00% | 1.04% | A: 3.12% |
| Intermediate | 90 | 37.80% | 44.40% | 3.33% | 6.67% | A: 7.78% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603303699 | C -> CA | LOC_Os06g06950.1 | upstream_gene_variant ; 555.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> CA | LOC_Os06g06960.1 | downstream_gene_variant ; 1484.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> CA | LOC_Os06g06950-LOC_Os06g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> T | LOC_Os06g06950.1 | upstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> T | LOC_Os06g06960.1 | downstream_gene_variant ; 1485.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> T | LOC_Os06g06950-LOC_Os06g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> A | LOC_Os06g06950.1 | upstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> A | LOC_Os06g06960.1 | downstream_gene_variant ; 1485.0bp to feature; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> A | LOC_Os06g06950-LOC_Os06g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| vg0603303699 | C -> DEL | N | N | silent_mutation | Average:61.674; most accessible tissue: Callus, score: 86.558 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603303699 | NA | 1.05E-09 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0603303699 | NA | 1.22E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0603303699 | NA | 6.85E-06 | mr1763 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303699 | 6.53E-07 | 6.53E-07 | mr1873 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303699 | NA | 4.10E-06 | mr1944 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303699 | NA | 2.59E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303699 | NA | 9.53E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |