Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603031631:

Variant ID: vg0603031631 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3031631
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATGGGTACCCGTTGGATACCCGTTACCCGCACAGGTGTGGGTATGGAGAAGATTTTCTACCCGTGATGGGTGTGGGTATTTAAGTGGGAATATTTAGA[C/T]
GTCGCGGGTGTGGGTATGGGGCAAGGGAATCCGATGGATATGCACCCGTTGCCATCCTACTCCCTCCATCCCATAATATAGCAATCTAGTACCGGACGAG

Reverse complement sequence

CTCGTCCGGTACTAGATTGCTATATTATGGGATGGAGGGAGTAGGATGGCAACGGGTGCATATCCATCGGATTCCCTTGCCCCATACCCACACCCGCGAC[G/A]
TCTAAATATTCCCACTTAAATACCCACACCCATCACGGGTAGAAAATCTTCTCCATACCCACACCTGTGCGGGTAACGGGTATCCAACGGGTACCCATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 11.30% 19.40% 0.95% NA
All Indica  2759 49.00% 18.30% 31.13% 1.63% NA
All Japonica  1512 99.50% 0.10% 0.33% 0.00% NA
Aus  269 87.70% 3.30% 8.92% 0.00% NA
Indica I  595 40.20% 10.60% 46.39% 2.86% NA
Indica II  465 77.20% 5.60% 13.98% 3.23% NA
Indica III  913 31.40% 34.70% 33.73% 0.11% NA
Indica Intermediate  786 59.30% 12.50% 26.72% 1.53% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.20% 0.79% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 19.80% 18.75% 0.00% NA
Intermediate  90 85.60% 2.20% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603031631 C -> T LOC_Os06g06450.1 upstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:51.5; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0603031631 C -> T LOC_Os06g06440-LOC_Os06g06450 intergenic_region ; MODIFIER silent_mutation Average:51.5; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N
vg0603031631 C -> DEL N N silent_mutation Average:51.5; most accessible tissue: Minghui63 panicle, score: 81.412 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0603031631 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603031631 8.93E-06 NA mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603031631 5.97E-06 NA mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603031631 NA 8.95E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603031631 5.44E-06 2.56E-07 mr1400_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251