Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602942802:

Variant ID: vg0602942802 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2942802
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGCAGTACTTATACGTAGCACATCGATCTGCACATGTTGGATGTAGCAAGAAATTGCTATGAAATATAAGTAGAGATGTGCTTAATATCAAATGTGT[A/G]
TCACATGTGAATCTATCAGCTGGGCATATATAGTGTCTCTTTCAGGCTTCCATCTCACTGTCTATCTCGCCCCCCACTGAATATGCCCAGTTTAAGGACA

Reverse complement sequence

TGTCCTTAAACTGGGCATATTCAGTGGGGGGCGAGATAGACAGTGAGATGGAAGCCTGAAAGAGACACTATATATGCCCAGCTGATAGATTCACATGTGA[T/C]
ACACATTTGATATTAAGCACATCTCTACTTATATTTCATAGCAATTTCTTGCTACATCCAACATGTGCAGATCGATGTGCTACGTATAAGTACTGCTACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.60% 0.04% 0.00% NA
All Indica  2759 90.70% 9.20% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 30.50% 69.50% 0.00% 0.00% NA
Indica I  595 87.90% 11.80% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 81.60% 18.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602942802 A -> G LOC_Os06g06330.1 upstream_gene_variant ; 2767.0bp to feature; MODIFIER silent_mutation Average:79.218; most accessible tissue: Minghui63 young leaf, score: 94.519 N N N N
vg0602942802 A -> G LOC_Os06g06340.1 upstream_gene_variant ; 4909.0bp to feature; MODIFIER silent_mutation Average:79.218; most accessible tissue: Minghui63 young leaf, score: 94.519 N N N N
vg0602942802 A -> G LOC_Os06g06320.1 downstream_gene_variant ; 350.0bp to feature; MODIFIER silent_mutation Average:79.218; most accessible tissue: Minghui63 young leaf, score: 94.519 N N N N
vg0602942802 A -> G LOC_Os06g06320-LOC_Os06g06330 intergenic_region ; MODIFIER silent_mutation Average:79.218; most accessible tissue: Minghui63 young leaf, score: 94.519 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0602942802 A G -0.02 0.23 0.1 0.08 0.09 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602942802 NA 4.07E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0602942802 NA 1.86E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 3.06E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 3.87E-06 1.18E-06 mr1755 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 2.68E-08 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 2.47E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 3.63E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 6.94E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 1.38E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602942802 NA 4.72E-08 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251