Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602898411:

Variant ID: vg0602898411 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 2898411
Reference Allele: C	Alternative Allele: T,CGGTATACCGTTCAAT
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCAAACATGCGTGATGATAATCCTAGCAGCACGCGACATACTCGGGAGAAGCCGGCACGCGGGGCCGCGTCATGGGGGATAAGCGGTATACCATTCAA[C/T,CGGTATACCGTTCAAT]
GGTATACCGTTGTGTAGTCTTTCTCTTTTAGTAATTAGGGAGTCGAGATATCCCGGTATTGTGGTTTAGGGATACGAATTAGATTAAGCCTCTAGTTAAG

Reverse complement sequence

CTTAACTAGAGGCTTAATCTAATTCGTATCCCTAAACCACAATACCGGGATATCTCGACTCCCTAATTACTAAAAGAGAAAGACTACACAACGGTATACC[G/A,ATTGAACGGTATACCG]
TTGAATGGTATACCGCTTATCCCCCATGACGCGGCCCCGCGTGCCGGCTTCTCCCGAGTATGTCGCGTGCTGCTAGGATTATCATCACGCATGTTTGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	8.80%	0.04%	0.00%	CGGTATACCGTTCAAT: 0.06%
All Indica	2759	92.00%	7.80%	0.07%	0.00%	CGGTATACCGTTCAAT: 0.07%
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	29.40%	70.30%	0.00%	0.00%	CGGTATACCGTTCAAT: 0.37%
Indica I	595	88.70%	10.90%	0.34%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	82.40%	17.30%	0.00%	0.00%	CGGTATACCGTTCAAT: 0.25%
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602898411	C -> T	LOC_Os06g06260.1	upstream_gene_variant ; 373.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06270.1	upstream_gene_variant ; 2404.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06280.1	upstream_gene_variant ; 3857.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06280.2	upstream_gene_variant ; 3872.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06250.2	downstream_gene_variant ; 2542.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06250.1	downstream_gene_variant ; 2542.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> T	LOC_Os06g06250-LOC_Os06g06260	intergenic_region ; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06260.1	upstream_gene_variant ; 372.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06270.1	upstream_gene_variant ; 2403.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06280.1	upstream_gene_variant ; 3856.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06280.2	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06250.2	downstream_gene_variant ; 2543.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06250.1	downstream_gene_variant ; 2543.0bp to feature; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N
vg0602898411	C -> CGGTATACCGTTCAAT	LOC_Os06g06250-LOC_Os06g06260	intergenic_region ; MODIFIER	silent_mutation	Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0602898411	C	CGGTA*	-0.03	0.02	0.08	-0.05	0.0	0.04
vg0602898411	C	T	-0.04	-0.04	-0.04	-0.04	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602898411	NA	1.22E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411	NA	3.44E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411	NA	2.57E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411	NA	2.85E-08	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411	NA	2.08E-09	mr1125_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251