Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602813024:

Variant ID: vg0602813024 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2813024
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGTCGCGAGATTTGGTCGCTTTCGGCCTCGTTTTGTAGCTCTCGCCTCTTTTTTTTTTGTGTGTGTTTTTTTTGTGTGTGGGTGTGTGTGTGCTCGCG[T/C]
GTGTTTTCTCTTGGGCTGTGGAGGTGGGGGTGGTGGCCCACCGGGGTATAAAATGGTTGGCACGCGGGGCTACGGGTACTAGGCGTGGCCCATTTTTGGG

Reverse complement sequence

CCCAAAAATGGGCCACGCCTAGTACCCGTAGCCCCGCGTGCCAACCATTTTATACCCCGGTGGGCCACCACCCCCACCTCCACAGCCCAAGAGAAAACAC[A/G]
CGCGAGCACACACACACCCACACACAAAAAAAACACACACAAAAAAAAAAGAGGCGAGAGCTACAAAACGAGGCCGAAAGCGACCAAATCTCGCGACGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	3.00%	5.01%	1.21%	NA
All Indica	2759	89.70%	1.50%	6.71%	2.03%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	46.10%	35.70%	18.22%	0.00%	NA
Indica I	595	90.10%	0.00%	8.91%	1.01%	NA
Indica II	465	96.60%	0.00%	2.80%	0.65%	NA
Indica III	913	86.90%	2.20%	6.68%	4.27%	NA
Indica Intermediate	786	88.80%	2.80%	7.38%	1.02%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	1.10%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602813024	T -> C	LOC_Os06g06090.1	upstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:99.693; most accessible tissue: Minghui63 root, score: 99.898	N	N	N	N
vg0602813024	T -> C	LOC_Os06g06090.2	upstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:99.693; most accessible tissue: Minghui63 root, score: 99.898	N	N	N	N
vg0602813024	T -> C	LOC_Os06g06100.1	downstream_gene_variant ; 2923.0bp to feature; MODIFIER	silent_mutation	Average:99.693; most accessible tissue: Minghui63 root, score: 99.898	N	N	N	N
vg0602813024	T -> C	LOC_Os06g06090-LOC_Os06g06100	intergenic_region ; MODIFIER	silent_mutation	Average:99.693; most accessible tissue: Minghui63 root, score: 99.898	N	N	N	N
vg0602813024	T -> DEL	N	N	silent_mutation	Average:99.693; most accessible tissue: Minghui63 root, score: 99.898	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0602813024	T	C	0.02	0.03	0.03	0.0	0.02	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602813024	NA	6.81E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	7.75E-07	NA	mr1125	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	1.39E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	2.06E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	4.90E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	2.80E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	1.27E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	4.26E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	1.06E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	6.61E-08	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	1.08E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	NA	1.61E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024	3.21E-06	NA	mr1125_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251