| Variant ID: vg0601571227 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1571227 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTAATGTCGTGTGAGTAAAGTGTGCCCCCTCTGCAGAGGTTATTAAACTGTTCGAACAGCCGTGCCCACAGTCATGGACGGATGTAAGGTGATTCCTTAG[C/T]
GTAGTTTTGTTTGACTACTGCTCTGTGAAATTGCTGTTGTGGACTTGGGTTCGATGTTTGGAACATCTGTGGCTGACGGGATCAGCTAGGCCCGGGTGGC
GCCACCCGGGCCTAGCTGATCCCGTCAGCCACAGATGTTCCAAACATCGAACCCAAGTCCACAACAGCAATTTCACAGAGCAGTAGTCAAACAAAACTAC[G/A]
CTAAGGAATCACCTTACATCCGTCCATGACTGTGGGCACGGCTGTTCGAACAGTTTAATAACCTCTGCAGAGGGGGCACACTTTACTCACACGACATTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.00% | 1.70% | 4.76% | 3.49% | NA |
| All Indica | 2759 | 84.70% | 2.80% | 6.96% | 5.47% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Aus | 269 | 86.20% | 0.40% | 8.55% | 4.83% | NA |
| Indica I | 595 | 84.20% | 0.20% | 9.41% | 6.22% | NA |
| Indica II | 465 | 75.10% | 9.00% | 9.03% | 6.88% | NA |
| Indica III | 913 | 89.70% | 0.50% | 5.59% | 4.16% | NA |
| Indica Intermediate | 786 | 85.10% | 3.80% | 5.47% | 5.60% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601571227 | C -> T | LOC_Os06g03900.1 | upstream_gene_variant ; 1195.0bp to feature; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0601571227 | C -> T | LOC_Os06g03910.1 | downstream_gene_variant ; 3257.0bp to feature; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0601571227 | C -> T | LOC_Os06g03890-LOC_Os06g03900 | intergenic_region ; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| vg0601571227 | C -> DEL | N | N | silent_mutation | Average:56.874; most accessible tissue: Minghui63 young leaf, score: 74.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601571227 | 3.12E-07 | 6.17E-10 | mr1310 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601571227 | NA | 6.03E-09 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601571227 | NA | 2.06E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601571227 | NA | 2.15E-08 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601571227 | NA | 9.11E-06 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601571227 | NA | 6.55E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |