Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601369122:

Variant ID: vg0601369122 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1369122
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTTACTCTTCATCTTTAGCAGGAAAACGACGTTGCTGCAACTGCAACGTACGATGCGTGCCATTACTGATAAGCTATCAATCGATCGAGTTGGTTGT[T/C]
TTGGACTTGATTTGTGATGATGAGATCATGAGATCTGAACATATTATTTGCATGCCTGTTGCTAATTAGAAGAGTAATGTACTCCATTGTGATTAACTAC

Reverse complement sequence

GTAGTTAATCACAATGGAGTACATTACTCTTCTAATTAGCAACAGGCATGCAAATAATATGTTCAGATCTCATGATCTCATCATCACAAATCAAGTCCAA[A/G]
ACAACCAACTCGATCGATTGATAGCTTATCAGTAATGGCACGCATCGTACGTTGCAGTTGCAGCAACGTCGTTTTCCTGCTAAAGATGAAGAGTAAAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 3.40% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 89.60% 10.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 84.20% 15.80% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601369122 T -> C LOC_Os06g03540.1 upstream_gene_variant ; 114.0bp to feature; MODIFIER silent_mutation Average:84.936; most accessible tissue: Zhenshan97 root, score: 96.965 N N N N
vg0601369122 T -> C LOC_Os06g03550.1 upstream_gene_variant ; 1184.0bp to feature; MODIFIER silent_mutation Average:84.936; most accessible tissue: Zhenshan97 root, score: 96.965 N N N N
vg0601369122 T -> C LOC_Os06g03530.1 downstream_gene_variant ; 1547.0bp to feature; MODIFIER silent_mutation Average:84.936; most accessible tissue: Zhenshan97 root, score: 96.965 N N N N
vg0601369122 T -> C LOC_Os06g03560.1 downstream_gene_variant ; 2706.0bp to feature; MODIFIER silent_mutation Average:84.936; most accessible tissue: Zhenshan97 root, score: 96.965 N N N N
vg0601369122 T -> C LOC_Os06g03540-LOC_Os06g03550 intergenic_region ; MODIFIER silent_mutation Average:84.936; most accessible tissue: Zhenshan97 root, score: 96.965 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601369122 T C 0.13 0.04 0.02 0.01 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601369122 NA 1.14E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0601369122 5.79E-07 5.79E-07 mr1577 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 NA 2.56E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 1.21E-06 1.89E-10 mr1549_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 NA 7.18E-06 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 NA 2.88E-10 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 NA 3.86E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601369122 NA 3.37E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251