Variant ID: vg0601365150 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 1365150 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 286. )
AACTTCCATTACAATTCTGAAAACTCAAGGAATACAATAATACAACACCAATTTCTCATCTTTACATGGTCTGGGAAAAAAACAGTGTTTATCCTATTTA[C/A]
GTTGGCCCCTACATGCTCCTTAAGATTGTCCAAATTCTCCCCAGGACTGACATACAATAGGAGATCCTCAAGTATAGACTGGGCATCCGTCAACAACTAC
GTAGTTGTTGACGGATGCCCAGTCTATACTTGAGGATCTCCTATTGTATGTCAGTCCTGGGGAGAATTTGGACAATCTTAAGGAGCATGTAGGGGCCAAC[G/T]
TAAATAGGATAAACACTGTTTTTTTCCCAGACCATGTAAAGATGAGAAATTGGTGTTGTATTATTGTATTCCTTGAGTTTTCAGAATTGTAATGGAAGTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0601365150 | C -> A | LOC_Os06g03540.1 | 3_prime_UTR_variant ; 68.0bp to feature; MODIFIER | silent_mutation | Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
vg0601365150 | C -> A | LOC_Os06g03520.1 | downstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
vg0601365150 | C -> A | LOC_Os06g03530.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.418; most accessible tissue: Zhenshan97 young leaf, score: 79.783 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0601365150 | 3.09E-06 | NA | mr1128_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0601365150 | 7.07E-07 | NA | mr1252_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0601365150 | 5.78E-06 | 7.73E-08 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0601365150 | 9.38E-06 | NA | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0601365150 | NA | 3.07E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |