RiceVarMap2

Detailed information for vg0601059247:

Variant ID: vg0601059247 (JBrowse)

Variation Type: SNP

Chromosome: chr06

Position: 1059247

Reference Allele: A

Alternative Allele: G

Primary Allele: A

Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.40, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTTGACCTTTTAGAACTATTTAAGGACTTTCATTCTGGGAGTTTGCCTTTATATTCGCTTAACTTTGGTACTATCATTCTTTTGCCTAAGTGTGCT[A/G]
AGGCTTTAAAGATTCAACAATATAGACCTATATGCCTACTTAATGTTAGCTTTAAGATTTTTACCAAAGTTGCTACAAATAGAATAATGGATGTTGCCCA

Reverse complement sequence

TGGGCAACATCCATTATTCTATTTGTAGCAACTTTGGTAAAAATCTTAAAGCTAACATTAAGTAGGCATATAGGTCTATATTGTTGAATCTTTAAAGCCT[T/C]
AGCACACTTAGGCAAAAGAATGATAGTACCAAAGTTAAGCGAATATAAAGGCAAACTCCCAGAATGAAAGTCCTTAAATAGTTCTAAAAGGTCAAATTTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	11.20%	30.36%	3.36%	NA
All Indica	2759	41.90%	12.00%	44.22%	1.88%	NA
All Japonica	1512	90.70%	0.30%	2.78%	6.22%	NA
Aus	269	3.70%	39.80%	55.76%	0.74%	NA
Indica I	595	70.40%	5.00%	22.52%	2.02%	NA
Indica II	465	62.40%	5.20%	29.46%	3.01%	NA
Indica III	913	14.20%	20.20%	64.29%	1.31%	NA
Indica Intermediate	786	40.50%	11.70%	46.06%	1.78%	NA
Temperate Japonica	767	93.60%	0.00%	3.00%	3.39%	NA
Tropical Japonica	504	84.10%	0.20%	2.78%	12.90%	NA
Japonica Intermediate	241	95.00%	1.70%	2.07%	1.24%	NA
VI/Aromatic	96	6.20%	82.30%	3.12%	8.33%	NA
Intermediate	90	64.40%	10.00%	22.22%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0601059247	A -> G	LOC_Os06g02880.1	missense_variant ; p.Lys540Glu; MODERATE	nonsynonymous_codon ; K540E	Average:24.016; most accessible tissue: Minghui63 young leaf, score: 33.985	benign	-0.65	TOLERATED	1.00
vg0601059247	A -> DEL	LOC_Os06g02880.1	N	frameshift_variant	Average:24.016; most accessible tissue: Minghui63 young leaf, score: 33.985	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0601059247	5.74E-06	5.74E-06	mr1300	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601059247	2.65E-06	2.42E-06	mr1310	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0601059247:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact