Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0600909609:

Variant ID: vg0600909609 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 909609
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCGAAGATGACCTGGCCGGCGTCGTGGCCGCAGCCCCAGAGCGCGCCCACGGCGGCGCTCTCCACCCGCGACCTCCCGATGGACAGCGGCGCCAGCGC[G/C]
GCGAGGTGGTCCGGCCCGGAGAGCGTGTGCAGGCAGCCGGCCAGGAACCCCGTCCACGCGCTGCTGAGCAGCTCCGACTTGAAGATGCCACCTCCCGCCT

Reverse complement sequence

AGGCGGGAGGTGGCATCTTCAAGTCGGAGCTGCTCAGCAGCGCGTGGACGGGGTTCCTGGCCGGCTGCCTGCACACGCTCTCCGGGCCGGACCACCTCGC[C/G]
GCGCTGGCGCCGCTGTCCATCGGGAGGTCGCGGGTGGAGAGCGCCGCCGTGGGCGCGCTCTGGGGCTGCGGCCACGACGCCGGCCAGGTCATCTTCGGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	4.20%	0.08%	0.00%	NA
All Indica	2759	95.30%	4.60%	0.14%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	77.00%	23.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	91.40%	8.20%	0.43%	0.00%	NA
Indica III	913	95.60%	4.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	6.20%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0600909609	G -> C	LOC_Os06g02580.1	synonymous_variant ; p.Ala163Ala; LOW	synonymous_codon	Average:90.944; most accessible tissue: Zhenshan97 flag leaf, score: 96.826	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0600909609	G	C	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0600909609	NA	3.12E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	7.49E-06	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	4.66E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	2.68E-06	NA	mr1663	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	1.81E-07	1.81E-07	mr1663	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	9.51E-06	9.50E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	6.77E-10	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	1.91E-08	mr1896	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	1.52E-08	mr1903	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	3.13E-11	mr1907	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	1.20E-08	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	8.93E-06	mr1956	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	1.76E-07	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	1.17E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	2.56E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	6.25E-07	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	3.73E-07	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0600909609	NA	2.21E-06	mr1720_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251