Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0529170841:

Variant ID: vg0529170841 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 29170841
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGAATTAATTAGACTCAATAGATTTGTCTCGCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACATTTAATATTTATAATTAATTTT[C/T]
AAACATCTGATGTGATAGGGACTTAAAAGTTTTAGTCCCATTTAAACAGGCTCTTAATAGGCCTCAGTTATCAACTAAGCTCAAGGCCCTGACAGACTAC

Reverse complement sequence

GTAGTCTGTCAGGGCCTTGAGCTTAGTTGATAACTGAGGCCTATTAAGAGCCTGTTTAAATGGGACTAAAACTTTTAAGTCCCTATCACATCAGATGTTT[G/A]
AAAATTAATTATAAATATTAAATGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGCGAGACAAATCTATTGAGTCTAATTAATTCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 4.60% 1.61% 0.47% NA
All Indica  2759 95.30% 1.30% 2.65% 0.80% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 33.80% 65.40% 0.74% 0.00% NA
Indica I  595 97.60% 0.20% 1.68% 0.50% NA
Indica II  465 90.80% 0.00% 6.45% 2.80% NA
Indica III  913 97.70% 0.50% 1.31% 0.44% NA
Indica Intermediate  786 93.40% 3.70% 2.67% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0529170841 C -> T LOC_Os05g50860.1 upstream_gene_variant ; 4481.0bp to feature; MODIFIER silent_mutation Average:80.215; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0529170841 C -> T LOC_Os05g50850-LOC_Os05g50860 intergenic_region ; MODIFIER silent_mutation Average:80.215; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N
vg0529170841 C -> DEL N N silent_mutation Average:80.215; most accessible tissue: Zhenshan97 panicle, score: 96.668 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0529170841 C T 0.04 0.03 0.02 0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0529170841 NA 6.01E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 7.13E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 5.16E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 5.06E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 3.09E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 3.89E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.16E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 2.35E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.47E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.14E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 9.11E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.97E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.36E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 5.21E-09 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.85E-06 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.06E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.06E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.93E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.11E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 1.01E-08 4.16E-48 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 1.23E-12 1.81E-59 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.98E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 5.05E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 2.99E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 6.90E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.22E-42 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 2.11E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 2.36E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 2.21E-35 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 4.50E-51 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 5.76E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0529170841 NA 1.59E-29 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251