Variant ID: vg0528325523 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 28325523 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
CCGCGACGAATGGTGGTTGACGTGGGATAGATGCACGTGGAGGCGAACGCTTCCTGCTAGTTGCTATGAACTGCTGCTGCTTCATACTTCCTCCGATTAA[C/T]
AATATAAGACTTTATAGGATTGCTCATATTTATATAGATATTAATGAATCTAGACATATATATGCATCTAGATTCAGTAACATCTAGTATATGAATATGA
TCATATTCATATACTAGATGTTACTGAATCTAGATGCATATATATGTCTAGATTCATTAATATCTATATAAATATGAGCAATCCTATAAAGTCTTATATT[G/A]
TTAATCGGAGGAAGTATGAAGCAGCAGCAGTTCATAGCAACTAGCAGGAAGCGTTCGCCTCCACGTGCATCTATCCCACGTCAACCACCATTCGTCGCGG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 2.10% | 1.21% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 91.40% | 5.00% | 3.64% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 88.40% | 6.30% | 5.35% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 83.80% | 10.40% | 5.81% | 0.00% | NA |
VI/Aromatic | 96 | 78.10% | 20.80% | 1.04% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0528325523 | C -> T | LOC_Os05g49400.1 | upstream_gene_variant ; 1896.0bp to feature; MODIFIER | silent_mutation | Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 | N | N | N | N |
vg0528325523 | C -> T | LOC_Os05g49410.1 | upstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 | N | N | N | N |
vg0528325523 | C -> T | LOC_Os05g49410.2 | upstream_gene_variant ; 3848.0bp to feature; MODIFIER | silent_mutation | Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 | N | N | N | N |
vg0528325523 | C -> T | LOC_Os05g49390.1 | intron_variant ; MODIFIER | silent_mutation | Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0528325523 | 1.88E-06 | NA | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0528325523 | NA | 1.66E-14 | Plant_height | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0528325523 | NA | 2.05E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 2.56E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 2.71E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 8.79E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 9.58E-07 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 1.78E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 2.03E-07 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0528325523 | NA | 5.32E-07 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |