Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528325523:

Variant ID: vg0528325523 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28325523
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCGACGAATGGTGGTTGACGTGGGATAGATGCACGTGGAGGCGAACGCTTCCTGCTAGTTGCTATGAACTGCTGCTGCTTCATACTTCCTCCGATTAA[C/T]
AATATAAGACTTTATAGGATTGCTCATATTTATATAGATATTAATGAATCTAGACATATATATGCATCTAGATTCAGTAACATCTAGTATATGAATATGA

Reverse complement sequence

TCATATTCATATACTAGATGTTACTGAATCTAGATGCATATATATGTCTAGATTCATTAATATCTATATAAATATGAGCAATCCTATAAAGTCTTATATT[G/A]
TTAATCGGAGGAAGTATGAAGCAGCAGCAGTTCATAGCAACTAGCAGGAAGCGTTCGCCTCCACGTGCATCTATCCCACGTCAACCACCATTCGTCGCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.70%	2.10%	1.21%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	91.40%	5.00%	3.64%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	88.40%	6.30%	5.35%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	83.80%	10.40%	5.81%	0.00%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528325523	C -> T	LOC_Os05g49400.1	upstream_gene_variant ; 1896.0bp to feature; MODIFIER	silent_mutation	Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217	N	N	N	N
vg0528325523	C -> T	LOC_Os05g49410.1	upstream_gene_variant ; 3899.0bp to feature; MODIFIER	silent_mutation	Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217	N	N	N	N
vg0528325523	C -> T	LOC_Os05g49410.2	upstream_gene_variant ; 3848.0bp to feature; MODIFIER	silent_mutation	Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217	N	N	N	N
vg0528325523	C -> T	LOC_Os05g49390.1	intron_variant ; MODIFIER	silent_mutation	Average:75.435; most accessible tissue: Zhenshan97 flower, score: 84.217	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528325523	1.88E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528325523	NA	1.66E-14	Plant_height	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0528325523	NA	2.05E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	2.56E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	2.71E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	8.79E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	9.58E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	1.78E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	2.03E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528325523	NA	5.32E-07	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251