Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528218584:

Variant ID: vg0528218584 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 28218584
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TCGATATGAAGTTGAGATCTAGCAAATCATTTTATATAAATCGTTATGCAGGATTTCTTTTTAATCATACGAGAAATAGGATCTTGCATAGCCTGATCAA[T/C]
TTAGGGGTAGCACTGATTAATATTTTTCCGGATTTTAATACTTCCTGGTTTGATTTAGTTTTTTTATCCACAAGGCTACAAATGTTGGTATGTTCGGCAA

Reverse complement sequence

TTGCCGAACATACCAACATTTGTAGCCTTGTGGATAAAAAAACTAAATCAAACCAGGAAGTATTAAAATCCGGAAAAATATTAATCAGTGCTACCCCTAA[A/G]
TTGATCAGGCTATGCAAGATCCTATTTCTCGTATGATTAAAAAGAAATCCTGCATAACGATTTATATAAAATGATTTGCTAGATCTCAACTTCATATCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	8.30%	1.10%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.07%	0.00%	NA
All Japonica	1512	72.60%	24.20%	3.24%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	57.10%	37.50%	5.35%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	66.40%	30.30%	3.32%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0528218584	T -> C	LOC_Os05g49170.1	upstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0528218584	T -> C	LOC_Os05g49180.1	upstream_gene_variant ; 1524.0bp to feature; MODIFIER	silent_mutation	Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0528218584	T -> C	LOC_Os05g49170-LOC_Os05g49180	intergenic_region ; MODIFIER	silent_mutation	Average:51.637; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0528218584	3.87E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	1.39E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	7.75E-08	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	NA	3.72E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	NA	1.46E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	1.51E-08	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	4.78E-06	7.63E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	NA	5.79E-08	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	3.84E-06	3.84E-06	mr1806_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	3.06E-07	NA	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528218584	2.95E-06	NA	mr1959_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251