Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0528017915:

Variant ID: vg0528017915 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 28017915
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGACTCGGCGGTGGCGAAACTTGGAGGTAGGGAGAGCAGAGGCGGCGGATCTAGCGCAGGGGATCTCCCGATCCAGCCGCGGCGACGACGGTGGGCTAGC[G/A]
GGTTGGGTGCTCCGGCGGTGGTGGCCGTCCTGCTGCTGCCGCTGTGCTTGATCCGGTTGTTCCACGCGTGGATGCAGGTGGCGCAGTCGACGGTCGTTGA

Reverse complement sequence

TCAACGACCGTCGACTGCGCCACCTGCATCCACGCGTGGAACAACCGGATCAAGCACAGCGGCAGCAGCAGGACGGCCACCACCGCCGGAGCACCCAACC[C/T]
GCTAGCCCACCGTCGTCGCCGCGGCTGGATCGGGAGATCCCCTGCGCTAGATCCGCCGCCTCTGCTCTCCCTACCTCCAAGTTTCGCCACCGCCGAGTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.50% 0.17% 0.00% NA
All Indica  2759 84.90% 14.90% 0.18% 0.00% NA
All Japonica  1512 6.00% 94.00% 0.07% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 94.80% 5.00% 0.17% 0.00% NA
Indica II  465 64.30% 35.70% 0.00% 0.00% NA
Indica III  913 84.10% 15.70% 0.22% 0.00% NA
Indica Intermediate  786 90.50% 9.30% 0.25% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 96.80% 0.20% 0.00% NA
Japonica Intermediate  241 25.70% 74.30% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0528017915 G -> A LOC_Os05g48860-LOC_Os05g48870 intergenic_region ; MODIFIER silent_mutation Average:71.028; most accessible tissue: Zhenshan97 young leaf, score: 90.728 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0528017915 G A -0.02 -0.05 -0.03 -0.03 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0528017915 NA 1.61E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 3.97E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.39E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.08E-12 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 8.18E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.29E-21 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 8.20E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.50E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.92E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 2.49E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 1.03E-35 mr1689_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0528017915 NA 8.75E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251