Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527885330:

Variant ID: vg0527885330 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 27885330
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAAACCGATCAAAAATCATTGATGCACATGGGAGTTTTGGCCGGTCTGAGACCCTATTTAGATTGGACTAAAACTTTCAAGTTACTATCATATCGGAT[A/G]
TTTGGACACTAACTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTCGAGCGACGAATCTATTGAGTCTAATTAATCC

Reverse complement sequence

GGATTAATTAGACTCAATAGATTCGTCGCTCGAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAGTTAGTGTCCAAA[T/C]
ATCCGATATGATAGTAACTTGAAAGTTTTAGTCCAATCTAAATAGGGTCTCAGACCGGCCAAAACTCCCATGTGCATCAATGATTTTTGATCGGTTTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.20% 24.20% 0.02% 0.61% NA
All Indica  2759 97.10% 2.80% 0.00% 0.04% NA
All Japonica  1512 33.90% 66.00% 0.07% 0.00% NA
Aus  269 89.60% 0.00% 0.00% 10.41% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 87.30% 12.70% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.30% 0.00% 0.13% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 83.80% 0.41% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0527885330 A -> DEL N N silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N
vg0527885330 A -> G LOC_Os05g48640.1 upstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N
vg0527885330 A -> G LOC_Os05g48650.1 upstream_gene_variant ; 920.0bp to feature; MODIFIER silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N
vg0527885330 A -> G LOC_Os05g48660.1 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N
vg0527885330 A -> G LOC_Os05g48660.2 downstream_gene_variant ; 1278.0bp to feature; MODIFIER silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N
vg0527885330 A -> G LOC_Os05g48650-LOC_Os05g48660 intergenic_region ; MODIFIER silent_mutation Average:84.025; most accessible tissue: Minghui63 root, score: 96.938 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0527885330 A G 0.01 0.02 0.02 0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0527885330 NA 7.35E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 8.69E-18 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 1.43E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 1.08E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 1.59E-61 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 3.53E-06 NA mr1347_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 6.53E-09 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 1.25E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 4.66E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527885330 NA 6.24E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251