Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527577536:

Variant ID: vg0527577536 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27577536
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, T: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

AATGAGTTGTTTATGAATGAAATCGAGATATTTCAACGAAATCGAATGGGGCCCTGGTTTGGTGAAGCAGCTATACTAGATTGCTTTCCTGTGTTTCAGG[A/T]
CTGCACTCTTATTCATTCCTGTCTTGTGCTGTATCTAGCTAGGGCCAATTAATAGAGTATTTTTCTTGAGGTAATTAGTGGATTATATGGATTCATTTAC

Reverse complement sequence

GTAAATGAATCCATATAATCCACTAATTACCTCAAGAAAAATACTCTATTAATTGGCCCTAGCTAGATACAGCACAAGACAGGAATGAATAAGAGTGCAG[T/A]
CCTGAAACACAGGAAAGCAATCTAGTATAGCTGCTTCACCAAACCAGGGCCCCATTCGATTTCGTTGAAATATCTCGATTTCATTCATAAACAACTCATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	47.30%	0.38%	0.02%	NA
All Indica	2759	70.30%	29.20%	0.51%	0.00%	NA
All Japonica	1512	29.40%	70.40%	0.20%	0.07%	NA
Aus	269	4.10%	95.90%	0.00%	0.00%	NA
Indica I	595	86.40%	13.40%	0.17%	0.00%	NA
Indica II	465	55.50%	43.90%	0.65%	0.00%	NA
Indica III	913	69.70%	29.90%	0.44%	0.00%	NA
Indica Intermediate	786	67.70%	31.60%	0.76%	0.00%	NA
Temperate Japonica	767	2.00%	97.80%	0.13%	0.13%	NA
Tropical Japonica	504	78.40%	21.20%	0.40%	0.00%	NA
Japonica Intermediate	241	14.10%	85.90%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	66.70%	1.04%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527577536	A -> T	LOC_Os05g48100.1	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:51.048; most accessible tissue: Callus, score: 94.142	N	N	N	N
vg0527577536	A -> T	LOC_Os05g48110.1	downstream_gene_variant ; 769.0bp to feature; MODIFIER	silent_mutation	Average:51.048; most accessible tissue: Callus, score: 94.142	N	N	N	N
vg0527577536	A -> T	LOC_Os05g48110-LOC_Os05g48120	intergenic_region ; MODIFIER	silent_mutation	Average:51.048; most accessible tissue: Callus, score: 94.142	N	N	N	N
vg0527577536	A -> DEL	N	N	silent_mutation	Average:51.048; most accessible tissue: Callus, score: 94.142	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527577536	NA	2.29E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	1.41E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	7.07E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	1.29E-06	4.57E-08	mr1817	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	2.64E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	5.82E-08	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	9.36E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	1.04E-16	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527577536	NA	1.20E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251