Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0527368751:

Variant ID: vg0527368751 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 27368751
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.36, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTGCTCCACAGCTCCACTCCACCTTAAAGACCCACTACCCTTTAATTTTTTAGTCTATTTACACAAAAATGCCATTGAGCTACCCTTCCTATCTTCT[T/C]
TCCTCCCGTTCTCTCTCCTCCCCCATCCTCCTCCCGAGGCCGGCCATGGAAGGTTTCATTTGCGTCGTTGGCAGCGAGCGGCGGCTGAGTCACGTCGGCG

Reverse complement sequence

CGCCGACGTGACTCAGCCGCCGCTCGCTGCCAACGACGCAAATGAAACCTTCCATGGCCGGCCTCGGGAGGAGGATGGGGGAGGAGAGAGAACGGGAGGA[A/G]
AGAAGATAGGAAGGGTAGCTCAATGGCATTTTTGTGTAAATAGACTAAAAAATTAAAGGGTAGTGGGTCTTTAAGGTGGAGTGGAGCTGTGGAGCAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	24.30%	0.49%	0.00%	NA
All Indica	2759	78.70%	20.70%	0.58%	0.00%	NA
All Japonica	1512	80.00%	19.80%	0.20%	0.00%	NA
Aus	269	19.00%	81.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	60.60%	38.90%	0.43%	0.00%	NA
Indica III	913	76.10%	23.20%	0.66%	0.00%	NA
Indica Intermediate	786	77.20%	21.90%	0.89%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	56.50%	43.10%	0.40%	0.00%	NA
Japonica Intermediate	241	68.50%	31.10%	0.41%	0.00%	NA
VI/Aromatic	96	66.70%	32.30%	1.04%	0.00%	NA
Intermediate	90	63.30%	33.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0527368751	T -> C	LOC_Os05g47770.1	downstream_gene_variant ; 1206.0bp to feature; MODIFIER	silent_mutation	Average:76.021; most accessible tissue: Callus, score: 90.616	N	N	N	N
vg0527368751	T -> C	LOC_Os05g47770-LOC_Os05g47780	intergenic_region ; MODIFIER	silent_mutation	Average:76.021; most accessible tissue: Callus, score: 90.616	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0527368751	NA	2.45E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	5.31E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	2.69E-12	mr1178	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	3.22E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	3.17E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	4.49E-08	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	9.72E-12	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	2.74E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	1.16E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	7.31E-07	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	1.29E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	5.40E-08	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	3.53E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0527368751	NA	5.96E-06	mr1876_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251