Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526033573:

Variant ID: vg0526033573 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 26033573
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGGATGAGGTCTGAGGGGAAGGGCGGACGAGGAGGGCGGATGGCGCGGGCCGGAGGTGCGAGCGGAGAGCTTTGGGCAGGGGGGACGGCGGCGCAGG[C/T]
GGCAGGGATGGCTTGGGTTGGCGGCGTAGGCGGCGGGGACGGCGACAGACGGCGGGGATGGCGTGGGTTGCTGGCGTAGATGGCGGGGACGGCGACGGGC

Reverse complement sequence

GCCCGTCGCCGTCCCCGCCATCTACGCCAGCAACCCACGCCATCCCCGCCGTCTGTCGCCGTCCCCGCCGCCTACGCCGCCAACCCAAGCCATCCCTGCC[G/A]
CCTGCGCCGCCGTCCCCCCTGCCCAAAGCTCTCCGCTCGCACCTCCGGCCCGCGCCATCCGCCCTCCTCGTCCGCCCTTCCCCTCAGACCTCATCCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	3.90%	1.02%	34.02%	NA
All Indica	2759	40.60%	6.60%	1.38%	51.40%	NA
All Japonica	1512	99.40%	0.00%	0.00%	0.60%	NA
Aus	269	37.20%	0.00%	3.72%	59.11%	NA
Indica I	595	33.60%	22.70%	2.52%	41.18%	NA
Indica II	465	34.60%	0.40%	0.43%	64.52%	NA
Indica III	913	48.60%	0.30%	1.42%	49.62%	NA
Indica Intermediate	786	40.20%	5.30%	1.02%	53.44%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	0.00%	0.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0526033573	C -> T	LOC_Os05g44780.1	upstream_gene_variant ; 2212.0bp to feature; MODIFIER	silent_mutation	Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0526033573	C -> T	LOC_Os05g44786.1	downstream_gene_variant ; 1505.0bp to feature; MODIFIER	silent_mutation	Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0526033573	C -> T	LOC_Os05g44780-LOC_Os05g44786	intergenic_region ; MODIFIER	silent_mutation	Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg0526033573	C -> DEL	N	N	silent_mutation	Average:32.714; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0526033573	NA	9.91E-08	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	1.65E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	2.23E-09	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	1.02E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	7.33E-08	mr1571	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	3.82E-08	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	1.01E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	1.27E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	4.91E-07	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526033573	NA	2.20E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251