Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525249866:

Variant ID: vg0525249866 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 25249866
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGACAGTCGAGTTACCGTTGCCGGAGTGCGTGATTTGCGACCGTTGGGTTTCTGCCCAACTGTGGAGACCGGTCCCACCTGTCACCAGGCTTTGGGAA[G/C]
TGGCGTCACGCCCGACCGCTTCTCTCGAGGAGGGCGATCGCCCTGGCATAACGCCGGGGGCTACTGTCGGTGACATGGGACCGGGAGTATCCTGACTAGG

Reverse complement sequence

CCTAGTCAGGATACTCCCGGTCCCATGTCACCGACAGTAGCCCCCGGCGTTATGCCAGGGCGATCGCCCTCCTCGAGAGAAGCGGTCGGGCGTGACGCCA[C/G]
TTCCCAAAGCCTGGTGACAGGTGGGACCGGTCTCCACAGTTGGGCAGAAACCCAACGGTCGCAAATCACGCACTCCGGCAACGGTAACTCGACTGTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.80%	3.80%	19.85%	9.50%	NA
All Indica	2759	44.90%	6.50%	32.62%	16.02%	NA
All Japonica	1512	99.80%	0.00%	0.13%	0.07%	NA
Aus	269	90.30%	0.40%	8.92%	0.37%	NA
Indica I	595	19.20%	1.00%	49.08%	30.76%	NA
Indica II	465	65.80%	2.80%	24.30%	7.10%	NA
Indica III	913	48.40%	13.30%	24.86%	13.47%	NA
Indica Intermediate	786	47.80%	5.00%	34.10%	13.10%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	82.20%	0.00%	12.22%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0525249866	G -> DEL	N	N	silent_mutation	Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0525249866	G -> C	LOC_Os05g43420.1	upstream_gene_variant ; 517.0bp to feature; MODIFIER	silent_mutation	Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0525249866	G -> C	LOC_Os05g43410.1	downstream_gene_variant ; 4429.0bp to feature; MODIFIER	silent_mutation	Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0525249866	G -> C	LOC_Os05g43440.1	downstream_gene_variant ; 4944.0bp to feature; MODIFIER	silent_mutation	Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0525249866	G -> C	LOC_Os05g43420-LOC_Os05g43440	intergenic_region ; MODIFIER	silent_mutation	Average:31.68; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0525249866	1.80E-06	2.88E-09	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866	1.61E-07	1.61E-07	mr1900	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866	NA	4.40E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866	NA	5.84E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0525249866	NA	7.37E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251