Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524699716:

Variant ID: vg0524699716 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24699716
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATTACTGCTCAGGCAGTGTTGGGAAAGGGAAATGATTTTCCACCTATCTTTAGATCCTAACCACTCATTCTCTCTCTTTCATTTAATCCCAACTCTTC[G/A]
TTCATTTCCTAATCCTAATCTCACCCCCCCCCCCCCAATTTCCTATTATCCAAACACACCCTCAGATGTCATGGTTAACAAGATTACCAAGCGGTTTCGT

Reverse complement sequence

ACGAAACCGCTTGGTAATCTTGTTAACCATGACATCTGAGGGTGTGTTTGGATAATAGGAAATTGGGGGGGGGGGGGTGAGATTAGGATTAGGAAATGAA[C/T]
GAAGAGTTGGGATTAAATGAAAGAGAGAGAATGAGTGGTTAGGATCTAAAGATAGGTGGAAAATCATTTCCCTTTCCCAACACTGCCTGAGCAGTAATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.00% 0.06% 0.00% NA
All Indica  2759 98.90% 1.00% 0.11% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 26.40% 73.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.40% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524699716 G -> A LOC_Os05g42220.1 downstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:68.647; most accessible tissue: Callus, score: 92.167 N N N N
vg0524699716 G -> A LOC_Os05g42230.1 downstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:68.647; most accessible tissue: Callus, score: 92.167 N N N N
vg0524699716 G -> A LOC_Os05g42240.1 downstream_gene_variant ; 2664.0bp to feature; MODIFIER silent_mutation Average:68.647; most accessible tissue: Callus, score: 92.167 N N N N
vg0524699716 G -> A LOC_Os05g42230-LOC_Os05g42240 intergenic_region ; MODIFIER silent_mutation Average:68.647; most accessible tissue: Callus, score: 92.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524699716 NA 6.93E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.23E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.10E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.18E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.20E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.42E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 5.71E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.82E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.48E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.53E-08 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.72E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.04E-06 mr1311 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 3.12E-06 NA mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 6.86E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 8.24E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 5.04E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.02E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 3.40E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 9.53E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 6.02E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.71E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 3.78E-10 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 6.77E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.28E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 7.28E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.66E-14 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 2.23E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.01E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.06E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 1.80E-09 1.67E-20 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 6.61E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.67E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 8.93E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.03E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 9.82E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 2.10E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 2.38E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.32E-24 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.79E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 8.58E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 8.25E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 2.30E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 8.01E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.26E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 7.64E-09 4.32E-13 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 4.83E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 2.33E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524699716 NA 1.90E-10 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251