Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0524373363:

Variant ID: vg0524373363 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 24373363
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATATATTTGCTCCAAAGTTGAAACAAATATAAATTGATCATTTGACTAATGTAAATTGTATCATACACCCTCCATCCCACAAAATATGGCATCTT[C/T]
TAGTACAACGAATCTGAATAAAGATATTTAGATTCGTTGTACTTGTGTGATCTCTTCTAGGTTGATTTTTTTTTATAGATGGAGTAGCTGTATAATGAAT

Reverse complement sequence

ATTCATTATACAGCTACTCCATCTATAAAAAAAAATCAACCTAGAAGAGATCACACAAGTACAACGAATCTAAATATCTTTATTCAGATTCGTTGTACTA[G/A]
AAGATGCCATATTTTGTGGGATGGAGGGTGTATGATACAATTTACATTAGTCAAATGATCAATTTATATTTGTTTCAACTTTGGAGCAAATATATATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 28.90% 14.71% 12.55% NA
All Indica  2759 8.40% 47.10% 24.21% 20.30% NA
All Japonica  1512 99.50% 0.30% 0.07% 0.07% NA
Aus  269 74.30% 10.40% 4.83% 10.41% NA
Indica I  595 2.90% 45.70% 29.08% 22.35% NA
Indica II  465 9.50% 48.80% 24.30% 17.42% NA
Indica III  913 12.90% 48.70% 20.70% 17.63% NA
Indica Intermediate  786 6.60% 45.30% 24.55% 23.54% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 46.70% 34.40% 14.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0524373363 C -> T LOC_Os05g41620.1 upstream_gene_variant ; 1612.0bp to feature; MODIFIER silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N
vg0524373363 C -> T LOC_Os05g41630.1 downstream_gene_variant ; 3549.0bp to feature; MODIFIER silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N
vg0524373363 C -> T LOC_Os05g41640.3 downstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N
vg0524373363 C -> T LOC_Os05g41640.1 downstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N
vg0524373363 C -> T LOC_Os05g41610.1 intron_variant ; MODIFIER silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N
vg0524373363 C -> DEL N N silent_mutation Average:82.667; most accessible tissue: Minghui63 root, score: 95.142 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0524373363 C T -0.01 -0.01 0.0 0.0 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0524373363 NA 1.28E-07 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 6.52E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 3.43E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 1.98E-30 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 7.23E-07 8.07E-18 mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 1.02E-12 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 1.32E-13 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 1.33E-19 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 5.23E-15 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 3.44E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 2.01E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 1.94E-62 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 5.77E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 7.82E-06 1.13E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 5.18E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 3.60E-11 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 2.14E-11 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 3.66E-12 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0524373363 NA 3.68E-11 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251