Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523131395:

Variant ID: vg0523131395 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23131395
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CACAGAGGAGGAGGCAAACCCTAGATTAATTTCGCGTGTGTTGCGTGAATGCGGCGGCACGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCA[C/T]
GATCTCCACTCTACGTAACCAAGCAGGATAAGTCGCGCGTTACTTATCCGGACTCCACACCGTTTTCACGCACCGGATTTTTCGGAATGTTTCCAACAAC

Reverse complement sequence

GTTGTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAACGGTGTGGAGTCCGGATAAGTAACGCGCGACTTATCCTGCTTGGTTACGTAGAGTGGAGATC[G/A]
TGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGTGCCGCCGCATTCACGCAACACACGCGAAATTAATCTAGGGTTTGCCTCCTCCTCTGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	18.40%	33.07%	6.16%	NA
All Indica	2759	12.10%	29.70%	48.06%	10.08%	NA
All Japonica	1512	99.10%	0.20%	0.66%	0.00%	NA
Aus	269	21.20%	14.10%	62.83%	1.86%	NA
Indica I	595	6.60%	27.70%	55.63%	10.08%	NA
Indica II	465	9.90%	31.00%	41.94%	17.20%	NA
Indica III	913	16.40%	30.60%	48.41%	4.60%	NA
Indica Intermediate	786	12.70%	29.50%	45.55%	12.21%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	98.40%	0.40%	1.19%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	70.80%	0.00%	29.17%	0.00%	NA
Intermediate	90	46.70%	11.10%	33.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523131395	C -> T	LOC_Os05g39430.1	upstream_gene_variant ; 554.0bp to feature; MODIFIER	silent_mutation	Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0523131395	C -> T	LOC_Os05g39440.1	downstream_gene_variant ; 642.0bp to feature; MODIFIER	silent_mutation	Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0523131395	C -> T	LOC_Os05g39430-LOC_Os05g39440	intergenic_region ; MODIFIER	silent_mutation	Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0523131395	C -> DEL	N	N	silent_mutation	Average:30.194; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523131395	3.14E-06	NA	mr1223_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	1.37E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	2.06E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	4.52E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	2.20E-12	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	2.38E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	8.81E-35	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	1.76E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523131395	NA	6.37E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251