Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523114802:

Variant ID: vg0523114802 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 23114802
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTTCGGAAGGGAGTGGCGGCTGTGGAGAACTTGATCGAGGAGCTACGGGACGATGTGGCACTGTTATATTATCAGGGTGAGACTTTGGCATTGTAAC[A/G]
TTTTCCAGTGGTGATTCAGATGTTCCAGACAAAAGCATCCTGTTCTTTTGGGAACGTTTTTGTTTGCTTGCTAGAAGTTTTCTTCTTGTGGCATTCTCTT

Reverse complement sequence

AAGAGAATGCCACAAGAAGAAAACTTCTAGCAAGCAAACAAAAACGTTCCCAAAAGAACAGGATGCTTTTGTCTGGAACATCTGAATCACCACTGGAAAA[T/C]
GTTACAATGCCAAAGTCTCACCCTGATAATATAACAGTGCCACATCGTCCCGTAGCTCCTCGATCAAGTTCTCCACAGCCGCCACTCCCTTCCGAACCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 28.70% 0.72% 0.00% NA
All Indica  2759 99.30% 0.60% 0.07% 0.00% NA
All Japonica  1512 11.00% 87.10% 1.92% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 15.60% 81.20% 3.13% 0.00% NA
Tropical Japonica  504 6.50% 92.70% 0.79% 0.00% NA
Japonica Intermediate  241 5.40% 94.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0523114802 A -> G LOC_Os05g39410.1 synonymous_variant ; p.Asn216Asn; LOW synonymous_codon Average:74.889; most accessible tissue: Callus, score: 85.065 N N N N
vg0523114802 A -> G LOC_Os05g39410.2 synonymous_variant ; p.Asn215Asn; LOW synonymous_codon Average:74.889; most accessible tissue: Callus, score: 85.065 N N N N
vg0523114802 A -> G LOC_Os05g39410.3 synonymous_variant ; p.Asn78Asn; LOW synonymous_codon Average:74.889; most accessible tissue: Callus, score: 85.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0523114802 NA 1.40E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.42E-19 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 4.61E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.86E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.25E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 6.27E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 9.26E-12 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 6.01E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.33E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 4.51E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.04E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.47E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 9.52E-11 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.19E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 8.42E-25 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.28E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.47E-20 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 4.40E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.12E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 8.68E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 9.32E-19 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 5.38E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.95E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.42E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.41E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.60E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 2.76E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 4.10E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.19E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 1.47E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 5.79E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 2.22E-06 2.12E-12 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 3.24E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 8.95E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 6.83E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 7.35E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523114802 NA 8.03E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251