Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0523054357:

Variant ID: vg0523054357 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 23054357
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:

TGCGGCGGCGGCCGTGCGGCAGCGGCGGAGCGAGGCGGCTGTGCGGCAGGCGGCCAGCGGCAGCGGCAGCCCATTTGCATATTTGTGTGGATAATTTTGT[G/A]
ATTCATTGCATGTTTGTATGGATCTGTGATGTATTTGATATGTTTGTAATTTTTGTAGGATTTGTGATGTATTTGATTTGTGTGTATAAGTAACTTTAAG

Reverse complement sequence

CTTAAAGTTACTTATACACACAAATCAAATACATCACAAATCCTACAAAAATTACAAACATATCAAATACATCACAGATCCATACAAACATGCAATGAAT[C/T]
ACAAAATTATCCACACAAATATGCAAATGGGCTGCCGCTGCCGCTGGCCGCCTGCCGCACAGCCGCCTCGCTCCGCCGCTGCCGCACGGCCGCCGCCGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	0.30%	4.25%	14.41%	NA
All Indica	2759	70.20%	0.50%	6.05%	23.23%	NA
All Japonica	1512	99.40%	0.00%	0.13%	0.46%	NA
Aus	269	82.50%	0.00%	9.29%	8.18%	NA
Indica I	595	58.70%	0.70%	6.72%	33.95%	NA
Indica II	465	63.20%	0.90%	8.39%	27.53%	NA
Indica III	913	81.40%	0.10%	3.83%	14.68%	NA
Indica Intermediate	786	70.20%	0.50%	6.74%	22.52%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	81.10%	0.00%	7.78%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0523054357	G -> DEL	N	N	silent_mutation	Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0523054357	G -> A	LOC_Os05g39310.1	upstream_gene_variant ; 4580.0bp to feature; MODIFIER	silent_mutation	Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0523054357	G -> A	LOC_Os05g39300-LOC_Os05g39310	intergenic_region ; MODIFIER	silent_mutation	Average:32.566; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0523054357	2.33E-06	5.89E-06	mr1166	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	7.21E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	9.23E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	8.57E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	1.88E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	6.13E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0523054357	NA	1.09E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251