Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522293773:

Variant ID: vg0522293773 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22293773
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTCGTGTCGGCCAAGTCGTCAAGAAGCTAGCTAGTCATTGCCAGTGGGCGCATTGTGCTAGGGGATGGCGAGAGGAGGAGGAGGAGGAGAGGAGGC[G/A]
GCGGAGGAGGAGAGGGAGGTGAGCGAGGCGCTGACGGCGGACTCGTCGGCCGACGAGGAGTGCCGCCGCGGGAGCAGCAGCTCCAGCGCAAGCTCCGGGG

Reverse complement sequence

CCCCGGAGCTTGCGCTGGAGCTGCTGCTCCCGCGGCGGCACTCCTCGTCGGCCGACGAGTCCGCCGTCAGCGCCTCGCTCACCTCCCTCTCCTCCTCCGC[C/T]
GCCTCCTCTCCTCCTCCTCCTCCTCTCGCCATCCCCTAGCACAATGCGCCCACTGGCAATGACTAGCTAGCTTCTTGACGACTTGGCCGACACGAACACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 35.40% 0.21% 0.53% NA
All Indica  2759 39.20% 59.60% 0.33% 0.91% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 36.00% 63.20% 0.17% 0.67% NA
Indica II  465 50.80% 47.70% 0.43% 1.08% NA
Indica III  913 31.80% 67.70% 0.00% 0.55% NA
Indica Intermediate  786 43.50% 54.30% 0.76% 1.40% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522293773 G -> DEL LOC_Os05g38000.2 N frameshift_variant Average:82.905; most accessible tissue: Zhenshan97 panicle, score: 93.351 N N N N
vg0522293773 G -> DEL LOC_Os05g38000.1 N frameshift_variant Average:82.905; most accessible tissue: Zhenshan97 panicle, score: 93.351 N N N N
vg0522293773 G -> A LOC_Os05g38000.1 synonymous_variant ; p.Ala11Ala; LOW synonymous_codon Average:82.905; most accessible tissue: Zhenshan97 panicle, score: 93.351 N N N N
vg0522293773 G -> A LOC_Os05g38000.2 synonymous_variant ; p.Ala11Ala; LOW synonymous_codon Average:82.905; most accessible tissue: Zhenshan97 panicle, score: 93.351 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0522293773 G A -0.03 -0.01 -0.01 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522293773 NA 1.13E-07 mr1058 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522293773 NA 7.25E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522293773 NA 6.70E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522293773 NA 1.23E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522293773 NA 2.24E-07 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522293773 NA 3.42E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251