Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521749530:

Variant ID: vg0521749530 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21749530
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 95. )

Flanking Sequence (100 bp) in Reference Genome:

GTGAAGGAAGAAGTGAGGTTTTCATTTACATGTAGGGTCTATCTATAATTTTTTAATTTCTTTGTTGATTAGGCTGTCACGTAGATGTGTCAGCGAAAAT[A/C]
TCTCTCAAAACAGCTGAGAGAATCGTTTTGCCCAAATTTAGTAGTTGGAGAGGTTGATATACCCAGTTTTATAGTTGAGGATACGAGTTAGATCGACCTA

Reverse complement sequence

TAGGTCGATCTAACTCGTATCCTCAACTATAAAACTGGGTATATCAACCTCTCCAACTACTAAATTTGGGCAAAACGATTCTCTCAGCTGTTTTGAGAGA[T/G]
ATTTTCGCTGACACATCTACGTGACAGCCTAATCAACAAAGAAATTAAAAAATTATAGATAGACCCTACATGTAAATGAAAACCTCACTTCTTCCTTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.30%	0.08%	0.02%	NA
All Indica	2759	98.60%	1.20%	0.11%	0.04%	NA
All Japonica	1512	6.70%	93.30%	0.00%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	99.50%	0.40%	0.00%	0.11%	NA
Indica Intermediate	786	97.10%	2.70%	0.25%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	17.30%	82.70%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	58.90%	41.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521749530	A -> DEL	N	N	silent_mutation	Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808	N	N	N	N
vg0521749530	A -> C	LOC_Os05g37200.1	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808	N	N	N	N
vg0521749530	A -> C	LOC_Os05g37200.3	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808	N	N	N	N
vg0521749530	A -> C	LOC_Os05g37200.2	upstream_gene_variant ; 1171.0bp to feature; MODIFIER	silent_mutation	Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808	N	N	N	N
vg0521749530	A -> C	LOC_Os05g37190-LOC_Os05g37200	intergenic_region ; MODIFIER	silent_mutation	Average:94.247; most accessible tissue: Zhenshan97 flower, score: 98.808	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0521749530	A	C	-0.01	-0.01	-0.01	0.01	0.0	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521749530	NA	6.40E-31	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	8.97E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	4.14E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	6.68E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	2.34E-06	8.43E-09	mr1227	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	1.96E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	3.50E-14	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	1.74E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	9.78E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	8.33E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	1.32E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	2.31E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	NA	6.15E-20	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	6.25E-06	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749530	8.13E-07	NA	mr1896	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251