Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521749407:

Variant ID: vg0521749407 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 21749407
Reference Allele: T	Alternative Allele: G,TAG,TAGAG
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTGCTAGTTAATTTTATGCATGCATGCACGCCTTATATTATGAAACATCTAAAAAATAGTTGTGTCTTATATTATGAAATAAAGGGAGTAACTTGAGA[T/G,TAG,TAGAG]
AGAGAGAGAGGAGGGGTGAGTGGTGAAGGAAGAAGTGAGGTTTTCATTTACATGTAGGGTCTATCTATAATTTTTTAATTTCTTTGTTGATTAGGCTGTC

Reverse complement sequence

GACAGCCTAATCAACAAAGAAATTAAAAAATTATAGATAGACCCTACATGTAAATGAAAACCTCACTTCTTCCTTCACCACTCACCCCTCCTCTCTCTCT[A/C,CTA,CTCTA]
TCTCAAGTTACTCCCTTTATTTCATAATATAAGACACAACTATTTTTTAGATGTTTCATAATATAAGGCGTGCATGCATGCATAAAATTAACTAGCACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	36.10%	0.32%	0.44%	TAG: 20.36%; TAGAG: 0.11%
All Indica	2759	63.80%	1.80%	0.33%	0.69%	TAG: 33.38%
All Japonica	1512	6.20%	92.80%	0.07%	0.00%	TAG: 0.66%; TAGAG: 0.33%
Aus	269	43.50%	50.20%	0.37%	0.00%	TAG: 5.95%
Indica I	595	45.40%	0.80%	0.34%	0.34%	TAG: 53.11%
Indica II	465	88.60%	1.70%	0.43%	0.86%	TAG: 8.39%
Indica III	913	57.70%	0.70%	0.00%	0.88%	TAG: 40.74%
Indica Intermediate	786	70.10%	3.90%	0.64%	0.64%	TAG: 24.68%
Temperate Japonica	767	1.00%	98.20%	0.13%	0.00%	TAG: 0.39%; TAGAG: 0.26%
Tropical Japonica	504	16.50%	82.50%	0.00%	0.00%	TAG: 0.79%; TAGAG: 0.20%
Japonica Intermediate	241	0.80%	97.10%	0.00%	0.00%	TAG: 1.24%; TAGAG: 0.83%
VI/Aromatic	96	2.10%	93.80%	1.04%	0.00%	TAG: 3.12%
Intermediate	90	47.80%	33.30%	3.33%	2.22%	TAG: 13.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521749407	T -> DEL	N	N	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> G	LOC_Os05g37200.1	upstream_gene_variant ; 1294.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> G	LOC_Os05g37200.3	upstream_gene_variant ; 1294.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> G	LOC_Os05g37200.2	upstream_gene_variant ; 1294.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> G	LOC_Os05g37190-LOC_Os05g37200	intergenic_region ; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAGAG	LOC_Os05g37200.1	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAGAG	LOC_Os05g37200.3	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAGAG	LOC_Os05g37200.2	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAGAG	LOC_Os05g37190-LOC_Os05g37200	intergenic_region ; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAG	LOC_Os05g37200.1	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAG	LOC_Os05g37200.3	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAG	LOC_Os05g37200.2	upstream_gene_variant ; 1293.0bp to feature; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N
vg0521749407	T -> TAG	LOC_Os05g37190-LOC_Os05g37200	intergenic_region ; MODIFIER	silent_mutation	Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0521749407	T	G	0.01	0.01	0.01	0.02	0.01	0.0
vg0521749407	T	TAG	-0.05	-0.18	-0.11	0.06	0.01	0.0
vg0521749407	T	TAGAG	0.07	-0.08	-0.04	0.0	0.06	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521749407	NA	1.90E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.14E-07	mr1115	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.92E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	7.51E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.35E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.47E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.83E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.92E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.16E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	6.29E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.10E-06	mr1611	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.33E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.73E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.89E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	4.89E-08	mr1735	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	9.88E-08	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	6.25E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.03E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	5.71E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.94E-06	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.59E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.12E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.63E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.48E-08	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.74E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.98E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.43E-06	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	1.11E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.23E-06	mr1415_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	2.57E-08	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	3.92E-14	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407	NA	5.80E-09	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251