Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521727029:

Variant ID: vg0521727029 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21727029
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTCGTCTTATTCAAAAACTTTTGTGAAATATATAAAACTATATGTATACATAAAAGTATATTTAACAATAAATTAAATGGTAGGAAAAGAATTAATAATT[G/A]
CTTAAATTTTTTGAATAAGACGAATGGACAAACATGTTTAAAAAAGTTAACGGCGTTAAATATTTAAGGATGGAGGGAGTATATATTCCATTTTCGCAGA

Reverse complement sequence

TCTGCGAAAATGGAATATATACTCCCTCCATCCTTAAATATTTAACGCCGTTAACTTTTTTAAACATGTTTGTCCATTCGTCTTATTCAAAAAATTTAAG[C/T]
AATTATTAATTCTTTTCCTACCATTTAATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTATATATTTCACAAAAGTTTTTGAATAAGACGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	10.70%	1.97%	2.33%	NA
All Indica	2759	75.30%	17.70%	3.12%	3.88%	NA
All Japonica	1512	99.40%	0.50%	0.07%	0.00%	NA
Aus	269	98.50%	0.00%	1.12%	0.37%	NA
Indica I	595	89.60%	5.50%	4.54%	0.34%	NA
Indica II	465	69.50%	19.80%	3.87%	6.88%	NA
Indica III	913	72.60%	21.70%	1.31%	4.38%	NA
Indica Intermediate	786	71.00%	21.10%	3.69%	4.20%	NA
Temperate Japonica	767	99.10%	0.80%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	7.80%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521727029	G -> DEL	N	N	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37180.1	upstream_gene_variant ; 3876.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.1	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.5	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.4	downstream_gene_variant ; 2464.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.3	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.2	downstream_gene_variant ; 2464.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.8	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170.6	downstream_gene_variant ; 2539.0bp to feature; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0521727029	G -> A	LOC_Os05g37170-LOC_Os05g37180	intergenic_region ; MODIFIER	silent_mutation	Average:63.163; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521727029	NA	3.30E-06	mr1029	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	1.63E-06	1.63E-06	mr1321	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	6.89E-06	NA	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	6.81E-07	6.81E-07	mr1338	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	8.95E-06	3.17E-06	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	NA	1.88E-06	mr1378	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	NA	4.09E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	9.76E-06	9.76E-06	mr1545	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	NA	5.87E-07	mr1625	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029	1.11E-06	1.11E-06	mr1782	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251