Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521701169:

Variant ID: vg0521701169 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21701169
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

GTATGAGTCGGTTTTTAAGTTCGTTCGCTTTTGGAAATACATAAGGAGTTGTATAAGAAAACTTGCATGATAACTTTAGACGAACAGACTCCTAATTGCA[G/A]
CTCATGATTTTCTAAAAATATATATATCCAAGTGAAATCCCACAATAAATTTCATCTTAACTATAATAAAATTAAAATAGTTTTCACCCGTTGCAACGCA

Reverse complement sequence

TGCGTTGCAACGGGTGAAAACTATTTTAATTTTATTATAGTTAAGATGAAATTTATTGTGGGATTTCACTTGGATATATATATTTTTAGAAAATCATGAG[C/T]
TGCAATTAGGAGTCTGTTCGTCTAAAGTTATCATGCAAGTTTTCTTATACAACTCCTTATGTATTTCCAAAAGCGAACGAACTTAAAAACCGACTCATAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	7.20%	2.37%	0.00%	NA
All Indica	2759	84.10%	12.00%	3.84%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	90.90%	1.50%	7.56%	0.00%	NA
Indica II	465	84.50%	13.10%	2.37%	0.00%	NA
Indica III	913	79.10%	20.40%	0.55%	0.00%	NA
Indica Intermediate	786	84.60%	9.70%	5.73%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	5.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521701169	G -> A	LOC_Os05g37130.1	3_prime_UTR_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37120.1	upstream_gene_variant ; 3345.0bp to feature; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37140.1	downstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37140.2	downstream_gene_variant ; 4503.0bp to feature; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37130.3	intron_variant ; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37130.5	intron_variant ; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37130.2	intron_variant ; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N
vg0521701169	G -> A	LOC_Os05g37130.4	intron_variant ; MODIFIER	silent_mutation	Average:45.274; most accessible tissue: Minghui63 root, score: 71.702	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521701169	5.24E-06	4.15E-06	mr1660	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521701169	NA	5.89E-06	mr1768	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251