Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521675477:

Variant ID: vg0521675477 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21675477
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCAATGATATTTTTCACCAAGACAAAAAAAACTTAATTACCATACATTTTAGGGTTAATTGGATCCATGCCTTTACAAATATGCTATTTAAAAAAAT[G/A]
CCACTACTATTAATGATATCGGTTACATGACACTTAAATTTGAGGAAATTGGAACCATACCACTCTATCATGTTTTCCGTCAGACCCCTAGACGTGGGTC

Reverse complement sequence

GACCCACGTCTAGGGGTCTGACGGAAAACATGATAGAGTGGTATGGTTCCAATTTCCTCAAATTTAAGTGTCATGTAACCGATATCATTAATAGTAGTGG[C/T]
ATTTTTTTAAATAGCATATTTGTAAAGGCATGGATCCAATTAACCCTAAAATGTATGGTAATTAAGTTTTTTTTGTCTTGGTGAAAAATATCATTGAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.50% 0.04% 0.23% NA
All Indica  2759 88.50% 11.20% 0.07% 0.22% NA
All Japonica  1512 6.10% 93.70% 0.00% 0.20% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 89.50% 10.30% 0.22% 0.00% NA
Indica III  913 79.10% 20.70% 0.00% 0.22% NA
Indica Intermediate  786 92.70% 6.60% 0.13% 0.51% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 16.10% 83.70% 0.00% 0.20% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521675477 G -> DEL N N silent_mutation Average:66.072; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0521675477 G -> A LOC_Os05g37090.1 upstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:66.072; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0521675477 G -> A LOC_Os05g37080-LOC_Os05g37090 intergenic_region ; MODIFIER silent_mutation Average:66.072; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521675477 NA 1.22E-30 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.59E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 5.18E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 9.04E-07 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 7.77E-24 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.17E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 8.74E-09 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 8.34E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.76E-22 mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.14E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.65E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.68E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.97E-29 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 7.48E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.54E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.01E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 9.61E-11 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 4.20E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 6.08E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 8.07E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 5.07E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 2.45E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 2.66E-15 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 2.06E-23 mr1845 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 3.99E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 7.95E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.41E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 2.61E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 1.84E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 NA 5.60E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521675477 9.00E-06 NA mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251