| Variant ID: vg0521485463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21485463 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCTGACTGCTCACATCAACGTCGGGAAAACTCTCCCTGACATGAGTACACGTCAGGAAATTTAATCTTGACACGCCTCCGTCACCCAAATTTATTTTTCT[C/G]
AGACAAGCTAGTCCTGACGGAATTTTCCTGACGTTGACACGTCACAAACAATTTTCCTGACATGTTTTTGTTTTATCCTGACGGTTTTTAGCCGTCATAA
TTATGACGGCTAAAAACCGTCAGGATAAAACAAAAACATGTCAGGAAAATTGTTTGTGACGTGTCAACGTCAGGAAAATTCCGTCAGGACTAGCTTGTCT[G/C]
AGAAAAATAAATTTGGGTGACGGAGGCGTGTCAAGATTAAATTTCCTGACGTGTACTCATGTCAGGGAGAGTTTTCCCGACGTTGATGTGAGCAGTCAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 8.80% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 72.40% | 25.60% | 2.05% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 2.60% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 34.90% | 61.70% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 23.20% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 7.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521485463 | C -> G | LOC_Os05g36250.1 | upstream_gene_variant ; 2932.0bp to feature; MODIFIER | silent_mutation | Average:41.054; most accessible tissue: Callus, score: 54.251 | N | N | N | N |
| vg0521485463 | C -> G | LOC_Os05g36230.1 | downstream_gene_variant ; 3610.0bp to feature; MODIFIER | silent_mutation | Average:41.054; most accessible tissue: Callus, score: 54.251 | N | N | N | N |
| vg0521485463 | C -> G | LOC_Os05g36240.1 | downstream_gene_variant ; 318.0bp to feature; MODIFIER | silent_mutation | Average:41.054; most accessible tissue: Callus, score: 54.251 | N | N | N | N |
| vg0521485463 | C -> G | LOC_Os05g36240-LOC_Os05g36250 | intergenic_region ; MODIFIER | silent_mutation | Average:41.054; most accessible tissue: Callus, score: 54.251 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521485463 | 1.77E-08 | NA | mr1016 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 9.18E-07 | 9.48E-15 | mr1016 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 3.48E-09 | NA | mr1017 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 4.42E-07 | 1.41E-15 | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 1.40E-10 | NA | mr1018 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 4.09E-06 | 3.62E-13 | mr1018 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 8.54E-07 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | NA | 2.23E-10 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 3.36E-08 | NA | mr1055 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521485463 | 5.29E-06 | 1.05E-14 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/