Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521119103:

Variant ID: vg0521119103 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21119103
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAGGGCATGTTTGGAAAAGTTTTTAGCTGCTACACTTTCTCTTAGAGTCTAGGTTTTAAAAACAAGTAGGTGTAGAATCCAGAAAATAAACTAGAAA[T/C]
CAGAAGCTTGGAAAACCAGCTAACAGGTCCTGGGAATATGCACTCTATTTTAGCCGCACATGTTTAACCGTGGGACATTTAATTTTTTTTTAACTTTTAA

Reverse complement sequence

TTAAAAGTTAAAAAAAAATTAAATGTCCCACGGTTAAACATGTGCGGCTAAAATAGAGTGCATATTCCCAGGACCTGTTAGCTGGTTTTCCAAGCTTCTG[A/G]
TTTCTAGTTTATTTTCTGGATTCTACACCTACTTGTTTTTAAAACCTAGACTCTAAGAGAAAGTGTAGCAGCTAAAAACTTTTCCAAACATGCCCTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	3.50%	0.93%	0.00%	NA
All Indica	2759	92.60%	5.80%	1.52%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	87.70%	8.70%	3.53%	0.00%	NA
Indica II	465	84.30%	12.90%	2.80%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	92.90%	6.10%	1.02%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521119103	T -> C	LOC_Os05g35530.1	upstream_gene_variant ; 1714.0bp to feature; MODIFIER	silent_mutation	Average:70.718; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg0521119103	T -> C	LOC_Os05g35520.1	downstream_gene_variant ; 1705.0bp to feature; MODIFIER	silent_mutation	Average:70.718; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg0521119103	T -> C	LOC_Os05g35520.2	downstream_gene_variant ; 1705.0bp to feature; MODIFIER	silent_mutation	Average:70.718; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg0521119103	T -> C	LOC_Os05g35520.3	downstream_gene_variant ; 1705.0bp to feature; MODIFIER	silent_mutation	Average:70.718; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N
vg0521119103	T -> C	LOC_Os05g35520-LOC_Os05g35530	intergenic_region ; MODIFIER	silent_mutation	Average:70.718; most accessible tissue: Minghui63 root, score: 88.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521119103	8.59E-06	1.62E-09	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	NA	1.40E-09	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	9.34E-08	1.20E-12	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	2.72E-06	2.11E-12	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	2.32E-09	2.17E-14	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	5.15E-08	3.78E-14	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	2.91E-06	NA	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	8.39E-06	NA	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	4.19E-08	1.41E-12	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103	6.90E-07	8.73E-13	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251