Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520492483:

Variant ID: vg0520492483 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20492483
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAGCTTTTGTAGAACCTGTGTTCTGTTTGTTTTTCTTGGAAACAAGGCTATAAACCCACCTCAACCATGATATATGGTTTAGATTTTCTCCATTTCTT[C/T]
AATTAATGTACGGAATTTTAAGGACCTCCGAACGAACGTGAGGCCTCATTTTTTCCGTTACTCTTGACTAGTTTACCACATCTAGAAGAGAGAAGCGTAC

Reverse complement sequence

GTACGCTTCTCTCTTCTAGATGTGGTAAACTAGTCAAGAGTAACGGAAAAAATGAGGCCTCACGTTCGTTCGGAGGTCCTTAAAATTCCGTACATTAATT[G/A]
AAGAAATGGAGAAAATCTAAACCATATATCATGGTTGAGGTGGGTTTATAGCCTTGTTTCCAAGAAAAACAAACAGAACACAGGTTCTACAAAAGCTTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.20%	1.14%	0.00%	NA
All Indica	2759	96.10%	2.10%	1.85%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	87.40%	6.70%	5.88%	0.00%	NA
Indica II	465	98.10%	1.10%	0.86%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	1.50%	1.53%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	1.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520492483	C -> T	LOC_Os05g34550.1	upstream_gene_variant ; 2300.0bp to feature; MODIFIER	silent_mutation	Average:51.765; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0520492483	C -> T	LOC_Os05g34550.2	upstream_gene_variant ; 2300.0bp to feature; MODIFIER	silent_mutation	Average:51.765; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0520492483	C -> T	LOC_Os05g34550.3	upstream_gene_variant ; 2300.0bp to feature; MODIFIER	silent_mutation	Average:51.765; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0520492483	C -> T	LOC_Os05g34560.1	downstream_gene_variant ; 472.0bp to feature; MODIFIER	silent_mutation	Average:51.765; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0520492483	C -> T	LOC_Os05g34560-LOC_Os05g34570	intergenic_region ; MODIFIER	silent_mutation	Average:51.765; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520492483	1.86E-08	1.86E-08	mr1335_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	NA	3.76E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	7.33E-06	NA	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	NA	8.63E-06	mr1568_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	NA	4.69E-06	mr1761_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	NA	1.55E-08	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	NA	2.31E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520492483	2.24E-06	2.24E-06	mr1991_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251