Variant ID: vg0520054493 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 20054493 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTAGAGTCCGTACAAAAATACAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAATATAGGAATACAATTTA[G/T]
AAGTAACTGAAATTTAAAATTTAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTGCACATAGAAATACAATTAGAAATAATAAAAATTCAGAATTAAA
TTTAATTCTGAATTTTTATTATTTCTAATTGTATTTCTATGTGCACTCTAAACTCATCTTTCAATATTCTTTAATTTTAAATTTTAAATTTCAGTTACTT[C/A]
TAAATTGTATTCCTATATTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTGTATTTTTGTACGGACTCTAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0520054493 | G -> T | LOC_Os05g33960.1 | upstream_gene_variant ; 3691.0bp to feature; MODIFIER | silent_mutation | Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg0520054493 | G -> T | LOC_Os05g33970.1 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg0520054493 | G -> T | LOC_Os05g33960-LOC_Os05g33970 | intergenic_region ; MODIFIER | silent_mutation | Average:19.372; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0520054493 | NA | 2.49E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 1.70E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 3.92E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 9.13E-08 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 7.75E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 5.10E-23 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 5.16E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 2.68E-07 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 4.53E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520054493 | NA | 1.44E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/