Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519921523:

Variant ID: vg0519921523 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19921523
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCCGCCAACGGCACCGTCATGTCACCTCGCAGCTTTCGTCACCACCAACACAGCCATCGTCGTCCTCGAGCTCAGCTTCCATCTCGCCATCAACGAGC[T/C]
CTCTGCTATAGTTCTTGTTGCCTCATCGGCGAGCTTTCCGCTCCGTCATCGTCAAGCACTTCGCACTCAAGCTCACCACGGTGGTCGCCGTTGCGCTGCC

Reverse complement sequence

GGCAGCGCAACGGCGACCACCGTGGTGAGCTTGAGTGCGAAGTGCTTGACGATGACGGAGCGGAAAGCTCGCCGATGAGGCAACAAGAACTATAGCAGAG[A/G]
GCTCGTTGATGGCGAGATGGAAGCTGAGCTCGAGGACGACGATGGCTGTGTTGGTGGTGACGAAAGCTGCGAGGTGACATGACGGTGCCGTTGGCGGCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	11.40%	7.49%	18.41%	NA
All Indica	2759	57.60%	18.80%	11.49%	12.14%	NA
All Japonica	1512	64.60%	0.30%	1.59%	33.53%	NA
Aus	269	95.20%	0.40%	2.97%	1.49%	NA
Indica I	595	71.60%	3.70%	13.61%	11.09%	NA
Indica II	465	45.80%	40.90%	9.25%	4.09%	NA
Indica III	913	54.00%	15.10%	12.16%	18.73%	NA
Indica Intermediate	786	58.00%	21.50%	10.43%	10.05%	NA
Temperate Japonica	767	95.40%	0.00%	0.91%	3.65%	NA
Tropical Japonica	504	10.10%	0.60%	3.17%	86.11%	NA
Japonica Intermediate	241	80.10%	0.80%	0.41%	18.67%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	54.40%	14.40%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519921523	T -> DEL	N	N	silent_mutation	Average:52.12; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N
vg0519921523	T -> C	LOC_Os05g33800.1	upstream_gene_variant ; 2516.0bp to feature; MODIFIER	silent_mutation	Average:52.12; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N
vg0519921523	T -> C	LOC_Os05g33810.1	upstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:52.12; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N
vg0519921523	T -> C	LOC_Os05g33800-LOC_Os05g33810	intergenic_region ; MODIFIER	silent_mutation	Average:52.12; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519921523	NA	1.65E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519921523	NA	3.02E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519921523	NA	2.10E-09	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519921523	NA	9.81E-08	mr1295_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519921523	NA	5.44E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519921523	NA	7.33E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251