Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519670973:

Variant ID: vg0519670973 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19670973
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGTCGAGACGGCGTAAAGGGTCATAAGGATAGGTTTCAACACTAGGTGTTATCAGAGTAAGGGATCGTCGGGTGAAAACACTTTGGTCGTGGTATGAA[A/G]
CCTAGAAATAGGCTTTATTGATACTGTAAGGGTGCTTACAGGTACGGCGTTATTGACTCATACATAGAATTTACGTAGTTGGTCAATGTTCCACGAATTT

Reverse complement sequence

AAATTCGTGGAACATTGACCAACTACGTAAATTCTATGTATGAGTCAATAACGCCGTACCTGTAAGCACCCTTACAGTATCAATAAAGCCTATTTCTAGG[T/C]
TTCATACCACGACCAAAGTGTTTTCACCCGACGATCCCTTACTCTGATAACACCTAGTGTTGAAACCTATCCTTATGACCCTTTACGCCGTCTCGACAAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.80%	10.60%	4.85%	41.75%	NA
All Indica	2759	18.80%	14.30%	4.89%	61.98%	NA
All Japonica	1512	89.40%	0.30%	0.26%	10.05%	NA
Aus	269	29.00%	32.70%	30.86%	7.43%	NA
Indica I	595	8.10%	7.90%	3.53%	80.50%	NA
Indica II	465	16.10%	18.10%	6.88%	58.92%	NA
Indica III	913	26.20%	18.00%	4.49%	51.37%	NA
Indica Intermediate	786	20.00%	12.70%	5.22%	62.09%	NA
Temperate Japonica	767	95.20%	0.70%	0.00%	4.17%	NA
Tropical Japonica	504	84.30%	0.00%	0.60%	15.08%	NA
Japonica Intermediate	241	81.30%	0.00%	0.41%	18.26%	NA
VI/Aromatic	96	29.20%	4.20%	3.12%	63.54%	NA
Intermediate	90	53.30%	8.90%	4.44%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519670973	A -> DEL	N	N	silent_mutation	Average:8.244; most accessible tissue: Callus, score: 11.921	N	N	N	N
vg0519670973	A -> G	LOC_Os05g33480.1	downstream_gene_variant ; 553.0bp to feature; MODIFIER	silent_mutation	Average:8.244; most accessible tissue: Callus, score: 11.921	N	N	N	N
vg0519670973	A -> G	LOC_Os05g33490.1	downstream_gene_variant ; 199.0bp to feature; MODIFIER	silent_mutation	Average:8.244; most accessible tissue: Callus, score: 11.921	N	N	N	N
vg0519670973	A -> G	LOC_Os05g33480-LOC_Os05g33490	intergenic_region ; MODIFIER	silent_mutation	Average:8.244; most accessible tissue: Callus, score: 11.921	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519670973	NA	7.34E-07	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	2.97E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	9.17E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	8.64E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	2.03E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	4.54E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	3.12E-06	3.12E-06	mr1445	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	4.22E-06	4.22E-06	mr1450	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	3.78E-06	mr1511	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	7.81E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519670973	NA	9.32E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251