Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517819523:

Variant ID: vg0517819523 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17819523
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGTTCTTAGGATTAGTGCTTACATCTTCATGACGCTCTAATCTTATTTATATAATTCGTCAAGTTACCATATACCTTATATAATCTTCAGCAATATCG[T/A]
TATCTAATCTACTATCGGCTAATATTTGTATGCAAAAGACAGCCGATTAGGTTAGATCTCGACATTGATCTAGATTATATAAGATATCTACCATTCTATG

Reverse complement sequence

CATAGAATGGTAGATATCTTATATAATCTAGATCAATGTCGAGATCTAACCTAATCGGCTGTCTTTTGCATACAAATATTAGCCGATAGTAGATTAGATA[A/T]
CGATATTGCTGAAGATTATATAAGGTATATGGTAACTTGACGAATTATATAAATAAGATTAGAGCGTCATGAAGATGTAAGCACTAATCCTAAGAACACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.50% 0.02% 0.00% NA
All Indica  2759 99.10% 0.80% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 34.90% 65.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517819523 T -> A LOC_Os05g30750.1 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30760.1 downstream_gene_variant ; 1853.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.2 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.3 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.6 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.5 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.7 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750.4 downstream_gene_variant ; 3058.0bp to feature; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0517819523 T -> A LOC_Os05g30750-LOC_Os05g30760 intergenic_region ; MODIFIER silent_mutation Average:30.576; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517819523 NA 2.53E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 3.10E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 2.56E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 2.76E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 8.30E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 3.33E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 7.76E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 1.01E-09 mr1652 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 1.18E-18 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 6.37E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 1.05E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 3.59E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 1.78E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517819523 NA 5.32E-23 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251