| Variant ID: vg0517773335 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17773335 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACTATCCCATCCAAGGGGTGTTAATTGGGGCTATTTCGGGTGGGACCCACTGAAAAAGTGTCTTCTCTCTATCTCTCTCCATGTGAAGGTACATTAAAG[G/T]
CCAAATAGCTCTCAAAATAACCCTTGGATCCAAATGATTAGAGTTATTTTATTGAAGGGCTATTTCCTTATGCTAAAAAAATAGCTCTCAAAATAACTCT
AGAGTTATTTTGAGAGCTATTTTTTTAGCATAAGGAAATAGCCCTTCAATAAAATAACTCTAATCATTTGGATCCAAGGGTTATTTTGAGAGCTATTTGG[C/A]
CTTTAATGTACCTTCACATGGAGAGAGATAGAGAGAAGACACTTTTTCAGTGGGTCCCACCCGAAATAGCCCCAATTAACACCCCTTGGATGGGATAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 2.40% | 1.16% | 60.18% | NA |
| All Indica | 2759 | 11.80% | 0.00% | 1.12% | 87.06% | NA |
| All Japonica | 1512 | 82.80% | 7.30% | 1.26% | 8.60% | NA |
| Aus | 269 | 1.50% | 0.00% | 0.37% | 98.14% | NA |
| Indica I | 595 | 14.30% | 0.00% | 2.02% | 83.70% | NA |
| Indica II | 465 | 31.40% | 0.00% | 1.08% | 67.53% | NA |
| Indica III | 913 | 1.40% | 0.00% | 0.11% | 98.47% | NA |
| Indica Intermediate | 786 | 10.30% | 0.10% | 1.65% | 87.91% | NA |
| Temperate Japonica | 767 | 89.70% | 6.60% | 1.04% | 2.61% | NA |
| Tropical Japonica | 504 | 72.00% | 6.30% | 1.19% | 20.44% | NA |
| Japonica Intermediate | 241 | 83.40% | 11.60% | 2.07% | 2.90% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 53.30% | 1.10% | 4.44% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517773335 | G -> T | LOC_Os05g30690.1 | downstream_gene_variant ; 972.0bp to feature; MODIFIER | silent_mutation | Average:32.291; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0517773335 | G -> T | LOC_Os05g30695.1 | downstream_gene_variant ; 2981.0bp to feature; MODIFIER | silent_mutation | Average:32.291; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0517773335 | G -> T | LOC_Os05g30680-LOC_Os05g30690 | intergenic_region ; MODIFIER | silent_mutation | Average:32.291; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0517773335 | G -> DEL | N | N | silent_mutation | Average:32.291; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517773335 | NA | 1.55E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0517773335 | 6.22E-06 | 6.22E-06 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517773335 | 2.90E-08 | 2.90E-08 | mr1914_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |