Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517737761:

Variant ID: vg0517737761 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17737761
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGATCCGTCGTTGACTAAGATCGACCCCGATCACCTGCACACACATGAATCAAACAACCGTTGTCTTGGCACAGATGTCGCAACCTGACCAATGTTAGT[C/A]
TACGCACACACTTCTTGCACTTCCGGTACTTGTCAATTTCCCATCACAAAAGAACTATAACCACACATGGTTTCACATCACTAGAGTCTTGAATAGGGAT

Reverse complement sequence

ATCCCTATTCAAGACTCTAGTGATGTGAAACCATGTGTGGTTATAGTTCTTTTGTGATGGGAAATTGACAAGTACCGGAAGTGCAAGAAGTGTGTGCGTA[G/T]
ACTAACATTGGTCAGGTTGCGACATCTGTGCCAAGACAACGGTTGTTTGATTCATGTGTGTGCAGGTGATCGGGGTCGATCTTAGTCAACGACGGATCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	2.40%	2.14%	41.39%	NA
All Indica	2759	39.80%	0.10%	3.12%	57.01%	NA
All Japonica	1512	84.60%	7.30%	0.66%	7.47%	NA
Aus	269	9.70%	0.00%	0.74%	89.59%	NA
Indica I	595	47.60%	0.20%	3.03%	49.24%	NA
Indica II	465	54.20%	0.00%	2.37%	43.44%	NA
Indica III	913	31.80%	0.10%	3.83%	64.29%	NA
Indica Intermediate	786	34.60%	0.10%	2.80%	62.47%	NA
Temperate Japonica	767	97.30%	0.10%	0.13%	2.48%	NA
Tropical Japonica	504	59.50%	21.00%	1.59%	17.86%	NA
Japonica Intermediate	241	96.70%	1.20%	0.41%	1.66%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	67.80%	2.20%	3.33%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517737761	C -> DEL	N	N	silent_mutation	Average:48.008; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0517737761	C -> A	LOC_Os05g30610.1	upstream_gene_variant ; 1636.0bp to feature; MODIFIER	silent_mutation	Average:48.008; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0517737761	C -> A	LOC_Os05g30620.1	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:48.008; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0517737761	C -> A	LOC_Os05g30630.1	downstream_gene_variant ; 4577.0bp to feature; MODIFIER	silent_mutation	Average:48.008; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N
vg0517737761	C -> A	LOC_Os05g30610-LOC_Os05g30620	intergenic_region ; MODIFIER	silent_mutation	Average:48.008; most accessible tissue: Minghui63 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517737761	NA	1.83E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	2.73E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	4.68E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	1.57E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	2.09E-06	7.04E-08	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	5.93E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	4.47E-07	4.47E-07	mr1436	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	6.20E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	2.42E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	1.18E-10	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	2.62E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	1.14E-07	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	2.35E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	2.28E-06	2.28E-06	mr1145_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	1.40E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761	NA	9.32E-08	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251