Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517577873:

Variant ID: vg0517577873 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17577873
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AACAAATCGTAGAGAAAGGAAAGAAAACAAATCAGGGAGAAAGGAAAGAGATGCCTCGGTGCGACAGAAAGGAAAGAGATGGCTCGATCTGATCCCGGCG[G/A]
AAATCAGAGACCCCTTCTCCCTCGATACGCGAAATTACCCCCCCGCACGCGCGTGGTACCCCGCTACCAATCCAACCTTAGCCGTGGCAGATCGACGGTA

Reverse complement sequence

TACCGTCGATCTGCCACGGCTAAGGTTGGATTGGTAGCGGGGTACCACGCGCGTGCGGGGGGGTAATTTCGCGTATCGAGGGAGAAGGGGTCTCTGATTT[C/T]
CGCCGGGATCAGATCGAGCCATCTCTTTCCTTTCTGTCGCACCGAGGCATCTCTTTCCTTTCTCCCTGATTTGTTTTCTTTCCTTTCTCTACGATTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.00%	23.80%	0.15%	0.00%	NA
All Indica	2759	94.70%	5.20%	0.07%	0.00%	NA
All Japonica	1512	42.10%	57.70%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	76.60%	23.40%	0.00%	0.00%	NA
Indica III	913	99.50%	0.30%	0.22%	0.00%	NA
Indica Intermediate	786	95.90%	4.10%	0.00%	0.00%	NA
Temperate Japonica	767	63.20%	36.60%	0.13%	0.00%	NA
Tropical Japonica	504	24.40%	75.40%	0.20%	0.00%	NA
Japonica Intermediate	241	12.00%	87.60%	0.41%	0.00%	NA
VI/Aromatic	96	12.50%	86.50%	1.04%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517577873	G -> A	LOC_Os05g30320.1	upstream_gene_variant ; 833.0bp to feature; MODIFIER	silent_mutation	Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N
vg0517577873	G -> A	LOC_Os05g30340.1	upstream_gene_variant ; 3386.0bp to feature; MODIFIER	silent_mutation	Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N
vg0517577873	G -> A	LOC_Os05g30310.1	downstream_gene_variant ; 949.0bp to feature; MODIFIER	silent_mutation	Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N
vg0517577873	G -> A	LOC_Os05g30310-LOC_Os05g30320	intergenic_region ; MODIFIER	silent_mutation	Average:62.696; most accessible tissue: Zhenshan97 young leaf, score: 82.077	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517577873	NA	1.43E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	6.35E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	9.72E-06	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	6.35E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	3.66E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	3.06E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	NA	2.71E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517577873	2.79E-06	NA	mr1806_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251