Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516694037:

Variant ID: vg0516694037 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16694037
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TGATTCCTTCTGTATTACCAAAAGTGAACGATCTTAAAAACCGACTCAAATACGGATATGTATTTCCAAAAGCAAACGAACTTAAAAACTGACTCATACA[C/T]
GGATGACATACCAAAATACCAGCAAAAACATCTTCAATTTTTATAATAGTAGAGATAGAGAAGAGATATAGATTAAAACCAAAACATAAAATTAAAACCG

Reverse complement sequence

CGGTTTTAATTTTATGTTTTGGTTTTAATCTATATCTCTTCTCTATCTCTACTATTATAAAAATTGAAGATGTTTTTGCTGGTATTTTGGTATGTCATCC[G/A]
TGTATGAGTCAGTTTTTAAGTTCGTTTGCTTTTGGAAATACATATCCGTATTTGAGTCGGTTTTTAAGATCGTTCACTTTTGGTAATACAGAAGGAATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.10%	0.30%	0.00%	NA
All Indica	2759	37.80%	61.70%	0.43%	0.00%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	22.90%	76.80%	0.34%	0.00%	NA
Indica II	465	60.00%	40.00%	0.00%	0.00%	NA
Indica III	913	38.60%	61.20%	0.22%	0.00%	NA
Indica Intermediate	786	35.20%	63.70%	1.02%	0.00%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516694037	C -> T	LOC_Os05g28510.1	upstream_gene_variant ; 2753.0bp to feature; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0516694037	C -> T	LOC_Os05g28510.2	upstream_gene_variant ; 2753.0bp to feature; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0516694037	C -> T	LOC_Os05g28510.3	upstream_gene_variant ; 2753.0bp to feature; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0516694037	C -> T	LOC_Os05g28510.4	upstream_gene_variant ; 2753.0bp to feature; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0516694037	C -> T	LOC_Os05g28500.1	downstream_gene_variant ; 2955.0bp to feature; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N
vg0516694037	C -> T	LOC_Os05g28500-LOC_Os05g28510	intergenic_region ; MODIFIER	silent_mutation	Average:36.78; most accessible tissue: Zhenshan97 root, score: 50.453	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516694037	NA	1.60E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	7.55E-06	mr1499_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	2.34E-06	mr1499_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	8.60E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	7.83E-06	mr1647_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	5.03E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	5.53E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	5.08E-08	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	9.63E-06	NA	mr1861_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516694037	NA	5.50E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251