Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516079925:

Variant ID: vg0516079925 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16079925
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGGTGGGACCCACCTGTCATACGCTCTCTCTCTCACTCTTCCTCTCTCTTCCTCTCTCTCTCACGGTCAGTGGTAGGCTGGGGCAGCGGCTGAGGGC[G/A]
GTGACCTCAGCGCGGAGGCGGCGGCGGAGGCGTCGCCGGTGGTGGTGCTACCGCCGCGTCGCCGCTCGGCCTAGACGAGGAGGAGGGGATGGGGAGGACG

Reverse complement sequence

CGTCCTCCCCATCCCCTCCTCCTCGTCTAGGCCGAGCGGCGACGCGGCGGTAGCACCACCACCGGCGACGCCTCCGCCGCCGCCTCCGCGCTGAGGTCAC[C/T]
GCCCTCAGCCGCTGCCCCAGCCTACCACTGACCGTGAGAGAGAGAGGAAGAGAGAGGAAGAGTGAGAGAGAGAGCGTATGACAGGTGGGTCCCACCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	49.50%	0.21%	0.00%	NA
All Indica	2759	64.40%	35.40%	0.22%	0.00%	NA
All Japonica	1512	24.60%	75.30%	0.07%	0.00%	NA
Aus	269	37.50%	62.50%	0.00%	0.00%	NA
Indica I	595	66.60%	33.30%	0.17%	0.00%	NA
Indica II	465	65.60%	34.40%	0.00%	0.00%	NA
Indica III	913	62.90%	37.00%	0.11%	0.00%	NA
Indica Intermediate	786	63.90%	35.60%	0.51%	0.00%	NA
Temperate Japonica	767	6.80%	93.20%	0.00%	0.00%	NA
Tropical Japonica	504	53.80%	46.20%	0.00%	0.00%	NA
Japonica Intermediate	241	20.30%	79.30%	0.41%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	45.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516079925	G -> A	LOC_Os05g27630.1	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:77.607; most accessible tissue: Minghui63 young leaf, score: 88.992	N	N	N	N
vg0516079925	G -> A	LOC_Os05g27640.1	downstream_gene_variant ; 328.0bp to feature; MODIFIER	silent_mutation	Average:77.607; most accessible tissue: Minghui63 young leaf, score: 88.992	N	N	N	N
vg0516079925	G -> A	LOC_Os05g27630-LOC_Os05g27640	intergenic_region ; MODIFIER	silent_mutation	Average:77.607; most accessible tissue: Minghui63 young leaf, score: 88.992	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0516079925	G	A	0.08	0.03	0.03	0.06	0.06	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516079925	NA	1.17E-12	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516079925	NA	3.33E-15	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0516079925	NA	2.62E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	2.28E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	1.53E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	7.13E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	1.39E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	1.34E-14	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	4.32E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	1.90E-08	mr1800	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	9.69E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	5.07E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516079925	NA	2.63E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251