Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515848994:

Variant ID: vg0515848994 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15848994
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.24, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ACTATAGATCCTGCAACAGCTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTTTGATGCTGCCGAGAGTTTCTGCTCTTTGATCATAA[A/C]
CACTTCGCTTCCATATCTTCGGTAAAGATGATTTGTTGAAAAGAGATTCTATGCCATATACCTTGTTGACTAAACATTTCTATTTCTGGACCAAACTCTC

Reverse complement sequence

GAGAGTTTGGTCCAGAAATAGAAATGTTTAGTCAACAAGGTATATGGCATAGAATCTCTTTTCAACAAATCATCTTTACCGAAGATATGGAAGCGAAGTG[T/G]
TTATGATCAAAGAGCAGAAACTCTCGGCAGCATCAAAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGCTGTTGCAGGATCTATAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	15.30%	10.35%	21.67%	NA
All Indica	2759	56.20%	9.50%	10.55%	23.74%	NA
All Japonica	1512	51.90%	26.30%	2.31%	19.44%	NA
Aus	269	28.60%	0.00%	49.44%	21.93%	NA
Indica I	595	46.60%	2.20%	8.24%	43.03%	NA
Indica II	465	51.00%	22.20%	9.03%	17.85%	NA
Indica III	913	65.10%	11.70%	9.64%	13.58%	NA
Indica Intermediate	786	56.20%	5.10%	14.25%	24.43%	NA
Temperate Japonica	767	86.40%	8.30%	0.00%	5.22%	NA
Tropical Japonica	504	9.50%	40.50%	5.56%	44.44%	NA
Japonica Intermediate	241	30.70%	53.90%	2.90%	12.45%	NA
VI/Aromatic	96	33.30%	50.00%	16.67%	0.00%	NA
Intermediate	90	50.00%	16.70%	15.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515848994	A -> DEL	N	N	silent_mutation	Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0515848994	A -> C	LOC_Os05g27270.1	upstream_gene_variant ; 3346.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0515848994	A -> C	LOC_Os05g27250.1	downstream_gene_variant ; 1126.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0515848994	A -> C	LOC_Os05g27260.1	downstream_gene_variant ; 773.0bp to feature; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N
vg0515848994	A -> C	LOC_Os05g27250-LOC_Os05g27260	intergenic_region ; MODIFIER	silent_mutation	Average:42.849; most accessible tissue: Minghui63 young leaf, score: 70.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515848994	NA	5.58E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	1.16E-08	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	8.16E-06	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	2.71E-10	1.29E-14	mr1709	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	8.09E-11	8.88E-20	mr1709	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	3.05E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	3.42E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	2.01E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	9.84E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	9.15E-09	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	5.21E-07	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	1.75E-17	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	5.99E-21	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	7.75E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515848994	NA	3.32E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251