| Variant ID: vg0515325210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 15325210 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTAGCCTACCTTCTGGTTGTCGATTAGCGTTGTATCGGAGTTTTAGCCGATCTTACTTGATTTAACTATATTTGCTCTATATGCTTTGGTGATACGTTA[A/T]
ATCTGCCCTTTTGGTCAAGATATTATCGCATCTAAGGATACTAAGCTTTTGTTTAGCATATTCTTCTTGTTTTAACATCTTAATATAGAATTGTATCGGA
TCCGATACAATTCTATATTAAGATGTTAAAACAAGAAGAATATGCTAAACAAAAGCTTAGTATCCTTAGATGCGATAATATCTTGACCAAAAGGGCAGAT[T/A]
TAACGTATCACCAAAGCATATAGAGCAAATATAGTTAAATCAAGTAAGATCGGCTAAAACTCCGATACAACGCTAATCGACAACCAGAAGGTAGGCTAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 3.20% | 12.04% | 12.06% | NA |
| All Indica | 2759 | 60.30% | 5.50% | 17.47% | 16.78% | NA |
| All Japonica | 1512 | 93.70% | 0.00% | 4.03% | 2.25% | NA |
| Aus | 269 | 71.40% | 0.00% | 4.46% | 24.16% | NA |
| Indica I | 595 | 57.60% | 2.70% | 26.39% | 13.28% | NA |
| Indica II | 465 | 57.80% | 7.70% | 15.91% | 18.49% | NA |
| Indica III | 913 | 65.20% | 6.80% | 9.31% | 18.73% | NA |
| Indica Intermediate | 786 | 58.00% | 4.70% | 21.12% | 16.16% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.65% | 1.30% | NA |
| Tropical Japonica | 504 | 85.70% | 0.00% | 9.72% | 4.56% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 2.90% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 0.00% | 15.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515325210 | A -> T | LOC_Os05g26340.1 | upstream_gene_variant ; 1016.0bp to feature; MODIFIER | silent_mutation | Average:9.685; most accessible tissue: Callus, score: 34.605 | N | N | N | N |
| vg0515325210 | A -> T | LOC_Os05g26340-LOC_Os05g26350 | intergenic_region ; MODIFIER | silent_mutation | Average:9.685; most accessible tissue: Callus, score: 34.605 | N | N | N | N |
| vg0515325210 | A -> DEL | N | N | silent_mutation | Average:9.685; most accessible tissue: Callus, score: 34.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515325210 | NA | 3.43E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515325210 | NA | 7.34E-07 | mr1551_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515325210 | NA | 3.17E-07 | mr1607_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515325210 | NA | 9.27E-06 | mr1637_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |