Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515288716:

Variant ID: vg0515288716 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15288716
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATGTTCAACAAGAGGTAAAACTTGTTATGACGTTTTGTGTTCTCGGGATTAGTGCTTC[T/C]
ATCTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATTTTACATAATCTCTGGCAATATCGCTATCTAACCTACGATCGGCTAAC

Reverse complement sequence

GTTAGCCGATCGTAGGTTAGATAGCGATATTGCCAGAGATTATGTAAAATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGAT[A/G]
GAAGCACTAATCCCGAGAACACAAAACGTCATAACAAGTTTTACCTCTTGTTGAACATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	6.30%	3.91%	19.61%	NA
All Indica	2759	80.40%	5.30%	0.65%	13.66%	NA
All Japonica	1512	55.70%	4.40%	10.65%	29.30%	NA
Aus	269	70.30%	29.00%	0.37%	0.37%	NA
Indica I	595	94.80%	1.50%	1.18%	2.52%	NA
Indica II	465	76.10%	0.60%	1.08%	22.15%	NA
Indica III	913	65.80%	10.80%	0.11%	23.22%	NA
Indica Intermediate	786	89.10%	4.30%	0.64%	5.98%	NA
Temperate Japonica	767	61.10%	7.80%	18.90%	12.13%	NA
Tropical Japonica	504	55.80%	0.80%	0.60%	42.86%	NA
Japonica Intermediate	241	38.20%	0.80%	5.39%	55.60%	NA
VI/Aromatic	96	9.40%	0.00%	1.04%	89.58%	NA
Intermediate	90	62.20%	11.10%	4.44%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515288716	T -> DEL	N	N	silent_mutation	Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0515288716	T -> C	LOC_Os05g26270.1	upstream_gene_variant ; 4363.0bp to feature; MODIFIER	silent_mutation	Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0515288716	T -> C	LOC_Os05g26280.1	upstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0515288716	T -> C	LOC_Os05g26290.1	upstream_gene_variant ; 976.0bp to feature; MODIFIER	silent_mutation	Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N
vg0515288716	T -> C	LOC_Os05g26280-LOC_Os05g26290	intergenic_region ; MODIFIER	silent_mutation	Average:18.746; most accessible tissue: Zhenshan97 root, score: 25.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515288716	7.36E-08	4.15E-10	mr1588_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515288716	NA	7.22E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251