Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515173997:

Variant ID: vg0515173997 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15173997
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.22, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CATTAATTTTTCGACTTTAAATAATTTTAATGCACTATTTTCTATTTTAGAAACACATATGTAATGGAAATTAATATTCAGTGCACTTATTAGTAGTCCC[A/G]
GTTCTTAACCCTAACCGGGTTTAAAAAGAATTTGGAAATAGCGGGAAAATATCTTTAGTCCCGGTTGATGAGAACAACCGGGAGTAAAGATAGCTTTACT

Reverse complement sequence

AGTAAAGCTATCTTTACTCCCGGTTGTTCTCATCAACCGGGACTAAAGATATTTTCCCGCTATTTCCAAATTCTTTTTAAACCCGGTTAGGGTTAAGAAC[T/C]
GGGACTACTAATAAGTGCACTGAATATTAATTTCCATTACATATGTGTTTCTAAAATAGAAAATAGTGCATTAAAATTATTTAAAGTCGAAAAATTAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	36.90%	1.57%	0.11%	NA
All Indica	2759	81.60%	16.50%	1.96%	0.00%	NA
All Japonica	1512	22.70%	75.90%	1.12%	0.33%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	88.60%	6.40%	5.04%	0.00%	NA
Indica II	465	72.70%	27.10%	0.22%	0.00%	NA
Indica III	913	75.20%	24.50%	0.22%	0.00%	NA
Indica Intermediate	786	88.80%	8.50%	2.67%	0.00%	NA
Temperate Japonica	767	6.10%	91.30%	1.96%	0.65%	NA
Tropical Japonica	504	49.20%	50.40%	0.40%	0.00%	NA
Japonica Intermediate	241	19.90%	80.10%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	46.70%	50.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515173997	A -> DEL	N	N	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0515173997	A -> G	LOC_Os05g26100.1	upstream_gene_variant ; 2347.0bp to feature; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0515173997	A -> G	LOC_Os05g26080.1	downstream_gene_variant ; 3401.0bp to feature; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0515173997	A -> G	LOC_Os05g26090.1	downstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0515173997	A -> G	LOC_Os05g26090-LOC_Os05g26100	intergenic_region ; MODIFIER	silent_mutation	Average:21.613; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515173997	NA	1.77E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	8.43E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	5.39E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	2.32E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	8.02E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	5.53E-06	5.75E-08	mr1623	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	1.84E-10	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	2.68E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	4.16E-08	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	3.24E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	4.23E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	1.37E-06	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	5.73E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	1.12E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	1.12E-06	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515173997	NA	4.36E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251