Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515087706:

Variant ID: vg0515087706 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15087706
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GCAAGATAGTAGGATATGTACTGACAAGTACATCTTAGATTATATTTACATGTCTGTCCTGAAGACGAACAGAATGATTCCTTCAAAACTGATTCATTGC[A/G]
AAAATGAAGTCAAGTGCACTTGCTGCTTGTTGCAACAGATATGAGCAGAAGTCCGGTGGTGGTGGATCCTAGGCAGGTGAACTCTCCAGTCTGCTTCTCT

Reverse complement sequence

AGAGAAGCAGACTGGAGAGTTCACCTGCCTAGGATCCACCACCACCGGACTTCTGCTCATATCTGTTGCAACAAGCAGCAAGTGCACTTGACTTCATTTT[T/C]
GCAATGAATCAGTTTTGAAGGAATCATTCTGTTCGTCTTCAGGACAGACATGTAAATATAATCTAAGATGTACTTGTCAGTACATATCCTACTATCTTGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.60%	40.80%	0.08%	0.49%	NA
All Indica	2759	44.50%	54.70%	0.11%	0.62%	NA
All Japonica	1512	77.40%	22.50%	0.00%	0.13%	NA
Aus	269	81.00%	19.00%	0.00%	0.00%	NA
Indica I	595	23.70%	76.00%	0.17%	0.17%	NA
Indica II	465	61.30%	37.80%	0.00%	0.86%	NA
Indica III	913	55.20%	44.00%	0.00%	0.77%	NA
Indica Intermediate	786	38.00%	61.10%	0.25%	0.64%	NA
Temperate Japonica	767	93.70%	6.10%	0.00%	0.13%	NA
Tropical Japonica	504	51.20%	48.60%	0.00%	0.20%	NA
Japonica Intermediate	241	80.10%	19.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	64.40%	31.10%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515087706	A -> DEL	N	N	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25960.1	upstream_gene_variant ; 2179.0bp to feature; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25940.1	downstream_gene_variant ; 4277.0bp to feature; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25950.1	downstream_gene_variant ; 1556.0bp to feature; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25974.1	downstream_gene_variant ; 4438.0bp to feature; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25974.2	downstream_gene_variant ; 4514.0bp to feature; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N
vg0515087706	A -> G	LOC_Os05g25950-LOC_Os05g25960	intergenic_region ; MODIFIER	silent_mutation	Average:66.557; most accessible tissue: Callus, score: 83.86	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515087706	NA	1.64E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	8.53E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	9.67E-12	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	2.85E-09	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	2.45E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	4.81E-06	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	3.36E-06	2.94E-14	mr1410_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	1.97E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515087706	NA	4.28E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251