Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514650516:

Variant ID: vg0514650516 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14650516
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTAGCTGCTTTCTTATTATAATCTGAGAGTCAAATTCCCAACATTGTAACCCCTCGTGAAATATGTGAAAGATTGACCGTAACCCCGTACACCCTTC[A/G]
TAAGAAAAAAAAATCTAGTATTAGATATTGAATATGCTAGTACTATAAATTTAATTAAAAAACATCTATATTTGTACTATTAGGATATATCCACGTTTAA

Reverse complement sequence

TTAAACGTGGATATATCCTAATAGTACAAATATAGATGTTTTTTAATTAAATTTATAGTACTAGCATATTCAATATCTAATACTAGATTTTTTTTTCTTA[T/C]
GAAGGGTGTACGGGGTTACGGTCAATCTTTCACATATTTCACGAGGGGTTACAATGTTGGGAATTTGACTCTCAGATTATAATAAGAAAGCAGCTACAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 48.30% 0.93% 0.21% NA
All Indica  2759 22.70% 76.80% 0.54% 0.04% NA
All Japonica  1512 95.70% 2.00% 1.72% 0.60% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 23.20% 76.00% 0.84% 0.00% NA
Indica II  465 25.20% 74.00% 0.86% 0.00% NA
Indica III  913 23.20% 76.60% 0.22% 0.00% NA
Indica Intermediate  786 20.10% 79.30% 0.51% 0.13% NA
Temperate Japonica  767 97.00% 2.90% 0.13% 0.00% NA
Tropical Japonica  504 92.70% 0.80% 4.76% 1.79% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514650516 A -> DEL N N silent_mutation Average:79.738; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0514650516 A -> G LOC_Os05g25240.1 downstream_gene_variant ; 2518.0bp to feature; MODIFIER silent_mutation Average:79.738; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0514650516 A -> G LOC_Os05g25240-LOC_Os05g25250 intergenic_region ; MODIFIER silent_mutation Average:79.738; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0514650516 A G 0.01 0.0 0.01 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514650516 7.44E-08 4.18E-30 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 1.94E-06 NA mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 NA 1.34E-28 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 NA 6.44E-07 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 2.77E-12 1.04E-37 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 2.09E-10 1.24E-09 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 NA 1.65E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 NA 5.08E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 NA 5.39E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 3.12E-13 9.28E-42 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 3.81E-10 3.31E-11 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 3.20E-07 1.83E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514650516 2.30E-08 5.02E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251