Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514329455:

Variant ID: vg0514329455 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 14329455
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATCTCTCTCCTTTCCTGGGAATTCGCACCGGCGGAGGTGCGTCTATTTAAGGGAGTTTTGGGGATCCCATTTGAGGTCAGCCTATTCAAAAAACTCTC[C/T]
AGCTTCCAAGCGTCCCTCGTCTTCTTCGCTCCTGCAAAAAAACCATAGCCAACTCGTCTCGGTCCTTTCTCCGGCGATCTCCGGTGGCCATGGATCTCGA

Reverse complement sequence

TCGAGATCCATGGCCACCGGAGATCGCCGGAGAAAGGACCGAGACGAGTTGGCTATGGTTTTTTTGCAGGAGCGAAGAAGACGAGGGACGCTTGGAAGCT[G/A]
GAGAGTTTTTTGAATAGGCTGACCTCAAATGGGATCCCCAAAACTCCCTTAAATAGACGCACCTCCGCCGGTGCGAATTCCCAGGAAAGGAGAGAGATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	48.40%	0.23%	0.25%	NA
All Indica	2759	84.50%	15.10%	0.22%	0.22%	NA
All Japonica	1512	2.60%	97.20%	0.07%	0.20%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	86.60%	12.80%	0.34%	0.34%	NA
Indica II	465	95.70%	4.10%	0.00%	0.22%	NA
Indica III	913	76.30%	23.40%	0.11%	0.11%	NA
Indica Intermediate	786	85.80%	13.60%	0.38%	0.25%	NA
Temperate Japonica	767	2.90%	97.00%	0.00%	0.13%	NA
Tropical Japonica	504	2.80%	97.00%	0.00%	0.20%	NA
Japonica Intermediate	241	1.20%	97.90%	0.41%	0.41%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	42.20%	50.00%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0514329455	C -> T	LOC_Os05g24720.1	upstream_gene_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0514329455	C -> T	LOC_Os05g24730.1	downstream_gene_variant ; 3713.0bp to feature; MODIFIER	silent_mutation	Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0514329455	C -> T	LOC_Os05g24710-LOC_Os05g24720	intergenic_region ; MODIFIER	silent_mutation	Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0514329455	C -> DEL	N	N	silent_mutation	Average:48.154; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0514329455	NA	3.21E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	8.63E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	2.89E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	3.94E-15	mr1329	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	3.08E-12	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	2.62E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	1.04E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	6.53E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514329455	NA	8.22E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251