Variant ID: vg0513464420 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 13464420 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATCAAGTCATTTGGTTGATTACAATTATCAAAACCACTCGGTTGGTTGGATTATTTATTCCTTGACTATACGCTTAGTTTGTTCAGCTAACCACATAGT[C/T]
GGAGGCTACACCTATTAGGTGCATCTAGTCGATGCACCTAACTTTATTTTCCAACCCTCCACAGTCTAGTCGAAGATTATCTTTTCGACTATGAAGGTCT
AGACCTTCATAGTCGAAAAGATAATCTTCGACTAGACTGTGGAGGGTTGGAAAATAAAGTTAGGTGCATCGACTAGATGCACCTAATAGGTGTAGCCTCC[G/A]
ACTATGTGGTTAGCTGAACAAACTAAGCGTATAGTCAAGGAATAAATAATCCAACCAACCGAGTGGTTTTGATAATTGTAATCAACCAAATGACTTGATA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.80% | 2.30% | 0.89% | 0.00% | NA |
All Indica | 2759 | 95.00% | 3.80% | 1.23% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.10% | 0.46% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 98.20% | 0.00% | 1.85% | 0.00% | NA |
Indica II | 465 | 77.60% | 19.80% | 2.58% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 1.50% | 1.27% | 0.00% | NA |
Temperate Japonica | 767 | 99.20% | 0.10% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0513464420 | C -> T | LOC_Os05g23500-LOC_Os05g23520 | intergenic_region ; MODIFIER | silent_mutation | Average:52.019; most accessible tissue: Minghui63 young leaf, score: 72.408 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0513464420 | 1.51E-12 | 5.67E-39 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 4.68E-09 | 2.63E-23 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 5.54E-11 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 3.01E-09 | 9.08E-13 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 3.08E-11 | 6.56E-44 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 1.35E-06 | 1.25E-25 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | NA | 2.79E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 2.02E-18 | 2.57E-33 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513464420 | 4.99E-14 | 1.71E-21 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |